Incidental Mutation 'R4411:Lmntd1'
ID327911
Institutional Source Beutler Lab
Gene Symbol Lmntd1
Ensembl Gene ENSMUSG00000054966
Gene Namelamin tail domain containing 1
SynonymsIfltd1, 4933403M22Rik, Lmna-rs1
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location145365134-145614319 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 145427277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111706] [ENSMUST00000111706] [ENSMUST00000111708] [ENSMUST00000111708] [ENSMUST00000148739] [ENSMUST00000149666]
Predicted Effect probably null
Transcript: ENSMUST00000111706
SMART Domains Protein: ENSMUSP00000107335
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 121 240 1.1e-18 PFAM
low complexity region 324 340 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111706
SMART Domains Protein: ENSMUSP00000107335
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 121 240 1.1e-18 PFAM
low complexity region 324 340 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111708
SMART Domains Protein: ENSMUSP00000107337
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 174 287 1.6e-12 PFAM
low complexity region 374 390 N/A INTRINSIC
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111708
SMART Domains Protein: ENSMUSP00000107337
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 174 287 1.6e-12 PFAM
low complexity region 374 390 N/A INTRINSIC
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148739
SMART Domains Protein: ENSMUSP00000120740
Gene: ENSMUSG00000054966

DomainStartEndE-ValueType
Pfam:LTD 24 144 1.2e-18 PFAM
low complexity region 228 244 N/A INTRINSIC
low complexity region 248 266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149666
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Lmntd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lmntd1 APN 6 145433722 missense possibly damaging 0.92
IGL01986:Lmntd1 APN 6 145419807 missense probably damaging 1.00
IGL02064:Lmntd1 APN 6 145427276 splice site probably null
IGL02430:Lmntd1 APN 6 145413414 missense probably benign 0.34
IGL03296:Lmntd1 APN 6 145413477 missense probably benign 0.23
PIT4514001:Lmntd1 UTSW 6 145427253 frame shift probably null
R0022:Lmntd1 UTSW 6 145429990 missense probably benign 0.06
R0050:Lmntd1 UTSW 6 145417476 missense probably damaging 1.00
R0084:Lmntd1 UTSW 6 145404528 missense unknown
R0631:Lmntd1 UTSW 6 145430000 missense probably benign 0.00
R1716:Lmntd1 UTSW 6 145419874 missense probably damaging 1.00
R1850:Lmntd1 UTSW 6 145413480 missense probably benign 0.06
R3898:Lmntd1 UTSW 6 145413426 missense probably benign 0.16
R5596:Lmntd1 UTSW 6 145413414 missense probably benign 0.34
R5944:Lmntd1 UTSW 6 145427316 missense probably damaging 0.99
R6711:Lmntd1 UTSW 6 145543502 missense probably benign 0.04
R7369:Lmntd1 UTSW 6 145413575 missense probably damaging 1.00
R7445:Lmntd1 UTSW 6 145429967 missense probably damaging 0.96
R7725:Lmntd1 UTSW 6 145543470 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCATGTTTGCTCCTCTGGAAAC -3'
(R):5'- TTAAAAGGCACCAGCTCCATGG -3'

Sequencing Primer
(F):5'- GCTCCTCTGGAAACTTCTATCAG -3'
(R):5'- ACCAGCTCCATGGTTCCACG -3'
Posted On2015-07-07