Mutagenetix > Incidental Mutations

Incidental Mutation 'R4411:Adprhl1'

327920

Institutional Source

Beutler Lab

Gene Symbol

Adprhl1

Ensembl Gene

ENSMUSG00000031448

Gene Name

ADP-ribosylhydrolase like 1

Synonyms

Arh2, D330008N11Rik

MMRRC Submission

041693-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13221663-13254162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 13246114 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 144 (K144E)

Ref Sequence

ENSEMBL: ENSMUSP00000145145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]

Predicted Effect

probably benign
Transcript: ENSMUST00000033825
AA Change: K144E

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: K144E

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	1.2e-53	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166438

Predicted Effect

probably benign
Transcript: ENSMUST00000168498
AA Change: K89E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448
AA Change: K89E

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	69	196	9e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171619
AA Change: K63E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448
AA Change: K63E

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	1	135	4.9e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204916
AA Change: K144E

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: K144E

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	4.2e-49	PFAM
low complexity region	509	527	N/A	INTRINSIC
low complexity region	955	969	N/A	INTRINSIC
internal_repeat_1	1047	1150	1.82e-5	PROSPERO
internal_repeat_1	1157	1274	1.82e-5	PROSPERO
low complexity region	1275	1290	N/A	INTRINSIC

Meta Mutation Damage Score

0.0986

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (62/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,151,955	I423V	probably benign	Het
Abl2	T	C	1: 156,630,082	V306A	possibly damaging	Het
Adcy4	T	C	14: 55,769,443	Y1006C	probably damaging	Het
Arid5b	T	C	10: 68,096,689	R885G	probably damaging	Het
Atp9a	A	T	2: 168,661,933	V613E	probably damaging	Het
Atxn7l1	G	T	12: 33,194,887		probably benign	Het
Brd8	C	A	18: 34,623,444		probably benign	Het
Bsnd	C	T	4: 106,486,671	R146H	probably benign	Het
C4b	C	T	17: 34,728,864	R1659H	probably damaging	Het
Duox1	G	A	2: 122,337,634	R1080H	probably benign	Het
Eml2	T	C	7: 19,182,401		probably null	Het
Fbxo44	G	A	4: 148,153,608	R221C	probably damaging	Het
Frem1	T	C	4: 82,963,244	D166G	probably damaging	Het
Galnt5	T	C	2: 57,999,195	L269P	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Gpc6	T	C	14: 117,951,178	V408A	probably benign	Het
Hspg2	A	G	4: 137,562,224	T3832A	probably benign	Het
Ift88	A	G	14: 57,477,979	N493S	probably damaging	Het
Ighv1-76	A	T	12: 115,848,111	C41S	probably damaging	Het
Igkv12-46	G	A	6: 69,764,946	T16I	probably benign	Het
Igkv3-9	G	T	6: 70,588,563	V49F	probably damaging	Het
Isoc2b	A	T	7: 4,849,434		probably benign	Het
Lcp2	T	A	11: 34,087,173		probably benign	Het
Lmntd1	A	G	6: 145,427,277		probably null	Het
Mdm2	A	T	10: 117,709,789		probably null	Het
Mrgprx3-ps	T	C	7: 47,309,998		noncoding transcript	Het
Msh2	T	C	17: 87,717,604	S637P	probably damaging	Het
Myo5b	T	C	18: 74,698,274	F765S	possibly damaging	Het
Nav2	T	A	7: 49,398,109	N91K	probably benign	Het
Ndor1	G	A	2: 25,248,480	P363S	probably benign	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Pcdhb5	T	C	18: 37,321,997	S477P	possibly damaging	Het
Pde3b	GTGATGATGATGATGATGATGATGATG	GTGATGATGATGATGATGATGATG	7: 114,534,749		probably benign	Het
Pnpla7	G	A	2: 25,051,704	W13*	probably null	Het
Pnpla8	T	C	12: 44,283,442	V41A	probably benign	Het
Prdm2	A	T	4: 143,133,670	S1017T	probably benign	Het
Prdm5	T	A	6: 65,901,787	Y108*	probably null	Het
Rab34	T	A	11: 78,188,766		probably null	Het
Smpd5	G	T	15: 76,294,912	R160L	possibly damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Taf5	T	A	19: 47,071,014	V199D	probably damaging	Het
Tas2r114	C	T	6: 131,689,622	V148I	probably benign	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tex43	A	G	18: 56,594,648	T65A	probably benign	Het
Tnfrsf25	G	A	4: 152,118,386		probably benign	Het
Tpd52l1	T	C	10: 31,379,319	T11A	possibly damaging	Het
Trmt1l	G	A	1: 151,452,154	E472K	probably benign	Het
Ttc17	T	C	2: 94,342,753	K766E	probably damaging	Het
Ttc37	A	G	13: 76,127,504	E410G	possibly damaging	Het
Ttn	C	T	2: 76,730,289	R29256Q	probably damaging	Het
Ttn	T	C	2: 76,742,070	I26160V	probably damaging	Het
Ubxn6	A	T	17: 56,069,303	V311E	probably damaging	Het
Usp2	T	C	9: 44,091,063	S351P	probably damaging	Het
Usp7	C	A	16: 8,708,914	D187Y	probably damaging	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Vmn2r58	T	A	7: 41,861,936	K481M	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Zfp455	A	T	13: 67,207,325	N219I	probably damaging	Het

Other mutations in Adprhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03268:Adprhl1	APN	8	13246170	splice site	probably benign
BB003:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB004:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB005:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB006:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB013:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB014:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB015:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB016:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R0244:Adprhl1	UTSW	8	13242391	splice site	probably benign
R0636:Adprhl1	UTSW	8	13248702	missense	probably damaging	1.00
R1295:Adprhl1	UTSW	8	13248624	missense	probably damaging	1.00
R2111:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2112:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2184:Adprhl1	UTSW	8	13242559	missense	probably benign	0.00
R4412:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4413:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4615:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R4618:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R5016:Adprhl1	UTSW	8	13224889	missense	possibly damaging	0.88
R5058:Adprhl1	UTSW	8	13242625	missense	probably damaging	1.00
R5060:Adprhl1	UTSW	8	13248621	missense	possibly damaging	0.63
R5209:Adprhl1	UTSW	8	13242563	nonsense	probably null
R6103:Adprhl1	UTSW	8	13222055	missense	possibly damaging	0.91
R6158:Adprhl1	UTSW	8	13224977	missense	possibly damaging	0.93
R6221:Adprhl1	UTSW	8	13225634	missense	probably benign	0.01
R6971:Adprhl1	UTSW	8	13223476	missense	probably benign
R7087:Adprhl1	UTSW	8	13221856	missense	probably damaging	0.99
R7362:Adprhl1	UTSW	8	13245534	missense	probably damaging	1.00
R7404:Adprhl1	UTSW	8	13225118	missense	probably damaging	0.99
R7422:Adprhl1	UTSW	8	13222873	missense	probably benign	0.28
R7439:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7441:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7772:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7773:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7774:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7776:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7876:Adprhl1	UTSW	8	13223509	missense	probably benign	0.00
R7877:Adprhl1	UTSW	8	13225316	nonsense	probably null
R7926:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7927:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7928:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7929:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7944:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7945:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7946:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7947:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7949:Adprhl1	UTSW	8	13224225	missense	possibly damaging	0.93
R8155:Adprhl1	UTSW	8	13221764	missense	probably damaging	0.99
R8182:Adprhl1	UTSW	8	13222774	missense	probably benign	0.07
Z1176:Adprhl1	UTSW	8	13225613	missense	probably benign	0.01
Z1177:Adprhl1	UTSW	8	13245476	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ATACAGGAACCATGGGAATTTCC -3'
(R):5'- AACTGCTTTCTTGCGACCTG -3'

Sequencing Primer
(F):5'- GGAATTTCCCCCTCGCATGG -3'
(R):5'- AGGGTTCCCGTGGCCTTTAC -3'

Posted On

2015-07-07