Incidental Mutation 'R4411:Usp2'
ID327921
Institutional Source Beutler Lab
Gene Symbol Usp2
Ensembl Gene ENSMUSG00000032010
Gene Nameubiquitin specific peptidase 2
Synonymsubp41, B930035K21Rik
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44067021-44095627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44091063 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 351 (S351P)
Ref Sequence ENSEMBL: ENSMUSP00000135018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034508] [ENSMUST00000065379] [ENSMUST00000065461] [ENSMUST00000114830] [ENSMUST00000162126] [ENSMUST00000175816] [ENSMUST00000176416] [ENSMUST00000177054] [ENSMUST00000185479]
Predicted Effect probably damaging
Transcript: ENSMUST00000034508
AA Change: S351P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034508
Gene: ENSMUSG00000032010
AA Change: S351P

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 8.4e-75 PFAM
Pfam:UCH_1 281 592 3.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065379
SMART Domains Protein: ENSMUSP00000070060
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065461
AA Change: S128P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070264
Gene: ENSMUSG00000032010
AA Change: S128P

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 57 387 7.5e-79 PFAM
Pfam:UCH_1 58 369 2.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114830
AA Change: S351P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110479
Gene: ENSMUSG00000032010
AA Change: S351P

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160985
SMART Domains Protein: ENSMUSP00000124568
Gene: ENSMUSG00000053128

DomainStartEndE-ValueType
RING 11 52 1.57e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162126
SMART Domains Protein: ENSMUSP00000123938
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162196
Predicted Effect probably benign
Transcript: ENSMUST00000175816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176022
Predicted Effect probably damaging
Transcript: ENSMUST00000176416
AA Change: S125P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135482
Gene: ENSMUSG00000032010
AA Change: S125P

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
Pfam:UCH 54 384 7.3e-79 PFAM
Pfam:UCH_1 55 366 2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177054
AA Change: S351P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135018
Gene: ENSMUSG00000032010
AA Change: S351P

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
Pfam:UCH 280 610 2.9e-78 PFAM
Pfam:UCH_1 281 592 7.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177422
Predicted Effect probably benign
Transcript: ENSMUST00000185479
SMART Domains Protein: ENSMUSP00000140405
Gene: ENSMUSG00000111409

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
transmembrane domain 225 247 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
RING 371 412 1.57e-2 SMART
Meta Mutation Damage Score 0.1867 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null mutation display severely reduced male fertility with defects in sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Usp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Usp2 APN 9 44089165 nonsense probably null
IGL01574:Usp2 APN 9 44093803 missense probably damaging 1.00
IGL02103:Usp2 APN 9 44089128 intron probably benign
IGL02391:Usp2 APN 9 44091227 missense probably damaging 1.00
R0385:Usp2 UTSW 9 44092750 missense probably damaging 0.99
R0555:Usp2 UTSW 9 44092784 missense probably damaging 1.00
R0614:Usp2 UTSW 9 44092492 nonsense probably null
R1553:Usp2 UTSW 9 44092155 missense probably damaging 0.99
R1851:Usp2 UTSW 9 44075966 missense probably benign 0.00
R2437:Usp2 UTSW 9 44092148 missense probably damaging 0.98
R3962:Usp2 UTSW 9 44075657 missense possibly damaging 0.82
R4392:Usp2 UTSW 9 44091259 missense probably damaging 1.00
R4894:Usp2 UTSW 9 44075828 missense probably benign 0.03
R4960:Usp2 UTSW 9 44075813 missense probably damaging 1.00
R5482:Usp2 UTSW 9 44089183 critical splice donor site probably null
R5496:Usp2 UTSW 9 44085208 missense possibly damaging 0.95
R5932:Usp2 UTSW 9 44092333 missense probably benign
R6956:Usp2 UTSW 9 44092756 missense probably damaging 1.00
R7007:Usp2 UTSW 9 44090042 missense probably damaging 1.00
R7224:Usp2 UTSW 9 44075969 missense possibly damaging 0.95
R7635:Usp2 UTSW 9 44067222 critical splice donor site probably null
R7707:Usp2 UTSW 9 44073460 intron probably null
RF007:Usp2 UTSW 9 44089121 critical splice acceptor site probably benign
RF012:Usp2 UTSW 9 44089130 critical splice acceptor site probably benign
RF015:Usp2 UTSW 9 44089109 critical splice acceptor site probably benign
RF036:Usp2 UTSW 9 44089124 critical splice acceptor site probably benign
RF046:Usp2 UTSW 9 44089111 critical splice acceptor site probably benign
RF051:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
RF053:Usp2 UTSW 9 44089129 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- GACCTCCTTGGGCACTCATAAG -3'
(R):5'- GGAATTCCTGAGCATCCTGC -3'

Sequencing Primer
(F):5'- TTGGGCACTCATAAGCATGC -3'
(R):5'- GCATCCTGCTGACTGAATGC -3'
Posted On2015-07-07