Incidental Mutation 'R4411:Arid5b'
ID327923
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene NameAT rich interactive domain 5B (MRF1-like)
Synonyms5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt
MMRRC Submission 041693-MU
Accession Numbers

Genbank: NM_023598; MGI: 2175912

Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location68092520-68278740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68096689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 885 (R885G)
Ref Sequence ENSEMBL: ENSMUSP00000151665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218532
AA Change: R885G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: R1128G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.5315 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 68128975 missense probably damaging 0.96
IGL01731:Arid5b APN 10 68097609 missense probably damaging 1.00
IGL02069:Arid5b APN 10 68097399 missense probably damaging 1.00
IGL02161:Arid5b APN 10 68096668 missense probably benign 0.00
IGL02555:Arid5b APN 10 68101904 missense probably benign 0.01
IGL02873:Arid5b APN 10 68101950 missense probably benign 0.06
IGL03119:Arid5b APN 10 68243227 missense probably damaging 1.00
IGL03271:Arid5b APN 10 68097457 missense possibly damaging 0.73
gobi UTSW 10 68118345 missense possibly damaging 0.92
3-1:Arid5b UTSW 10 68098589 missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 68098011 missense probably damaging 0.99
R0108:Arid5b UTSW 10 68278729 utr 5 prime probably benign
R0525:Arid5b UTSW 10 68097846 missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68186033 missense probably damaging 1.00
R0646:Arid5b UTSW 10 68096977 missense probably damaging 1.00
R1066:Arid5b UTSW 10 68098356 missense probably benign 0.04
R1487:Arid5b UTSW 10 68097214 nonsense probably null
R1638:Arid5b UTSW 10 68277947 missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68186067 missense probably damaging 0.99
R2031:Arid5b UTSW 10 68278688 critical splice donor site probably null
R2337:Arid5b UTSW 10 68097777 missense possibly damaging 0.63
R2996:Arid5b UTSW 10 68098462 missense probably benign 0.01
R2997:Arid5b UTSW 10 68098462 missense probably benign 0.01
R3547:Arid5b UTSW 10 68098462 missense probably benign 0.01
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R4860:Arid5b UTSW 10 68243095 missense probably damaging 0.97
R5219:Arid5b UTSW 10 68278110 missense probably benign 0.08
R5341:Arid5b UTSW 10 68278127 missense possibly damaging 0.87
R5434:Arid5b UTSW 10 68096889 missense possibly damaging 0.67
R5757:Arid5b UTSW 10 68102079 missense probably damaging 1.00
R6114:Arid5b UTSW 10 68097744 missense possibly damaging 0.89
R6313:Arid5b UTSW 10 68097582 missense possibly damaging 0.95
R6338:Arid5b UTSW 10 68098561 nonsense probably null
R6525:Arid5b UTSW 10 68097666 missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68186212 nonsense probably null
R7013:Arid5b UTSW 10 68097819 missense probably damaging 1.00
R7099:Arid5b UTSW 10 68098179 missense probably damaging 1.00
R7260:Arid5b UTSW 10 68097807 missense probably damaging 1.00
R7324:Arid5b UTSW 10 68128922 missense probably benign 0.44
R7334:Arid5b UTSW 10 68243177 missense possibly damaging 0.61
R7432:Arid5b UTSW 10 68118266 missense probably damaging 1.00
R7453:Arid5b UTSW 10 68243164 missense probably benign 0.01
R7649:Arid5b UTSW 10 68118345 missense possibly damaging 0.92
R7659:Arid5b UTSW 10 68098587 missense probably benign
R7661:Arid5b UTSW 10 68098587 missense probably benign
R7662:Arid5b UTSW 10 68098587 missense probably benign
R7663:Arid5b UTSW 10 68098587 missense probably benign
R7665:Arid5b UTSW 10 68098587 missense probably benign
R7666:Arid5b UTSW 10 68098587 missense probably benign
R7759:Arid5b UTSW 10 68097802 missense probably damaging 1.00
R7779:Arid5b UTSW 10 68096776 missense probably damaging 1.00
R7788:Arid5b UTSW 10 68098587 missense probably benign
R7789:Arid5b UTSW 10 68098587 missense probably benign
R7875:Arid5b UTSW 10 68128941 missense probably benign 0.02
R7958:Arid5b UTSW 10 68128941 missense probably benign 0.02
R8079:Arid5b UTSW 10 68098356 missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68186152 missense probably benign 0.00
R8228:Arid5b UTSW 10 68278706 missense possibly damaging 0.95
X0066:Arid5b UTSW 10 68118302 missense probably damaging 1.00
Z1177:Arid5b UTSW 10 68097228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGAGGCTTACAGTTTTGTGC -3'
(R):5'- CTGGGAAAGAAAAGGCCTCC -3'

Sequencing Primer
(F):5'- CTGGGGTGTACGGATGACAGC -3'
(R):5'- CTGCCTCAGAAGGGCACAAG -3'
Posted On2015-07-07