Incidental Mutation 'R4411:Rab34'
ID327927
Institutional Source Beutler Lab
Gene Symbol Rab34
Ensembl Gene ENSMUSG00000002059
Gene NameRAB34, member RAS oncogene family
SynonymsRah1, Narr
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4411 (G1)
Quality Score165
Status Validated
Chromosome11
Chromosomal Location78188430-78192193 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 78188766 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002128] [ENSMUST00000056241] [ENSMUST00000078099] [ENSMUST00000108322] [ENSMUST00000108322] [ENSMUST00000150941] [ENSMUST00000207728]
Predicted Effect probably benign
Transcript: ENSMUST00000002128
SMART Domains Protein: ENSMUSP00000002128
Gene: ENSMUSG00000002059

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056241
SMART Domains Protein: ENSMUSP00000059769
Gene: ENSMUSG00000002059

DomainStartEndE-ValueType
Pfam:Arf 43 205 9.5e-13 PFAM
Pfam:Miro 54 166 9.3e-17 PFAM
Pfam:MMR_HSR1 54 204 4.4e-7 PFAM
Pfam:Ras 54 210 4.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078099
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108322
SMART Domains Protein: ENSMUSP00000103958
Gene: ENSMUSG00000002059

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108322
SMART Domains Protein: ENSMUSP00000103958
Gene: ENSMUSG00000002059

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148603
Predicted Effect probably benign
Transcript: ENSMUST00000150941
SMART Domains Protein: ENSMUSP00000123033
Gene: ENSMUSG00000002059

DomainStartEndE-ValueType
RAB 60 225 2.96e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154542
Predicted Effect probably benign
Transcript: ENSMUST00000156435
SMART Domains Protein: ENSMUSP00000122848
Gene: ENSMUSG00000002059

DomainStartEndE-ValueType
Pfam:Arf 1 167 4.1e-17 PFAM
Pfam:Roc 6 122 4.5e-32 PFAM
Pfam:MMR_HSR1 6 156 2.3e-8 PFAM
Pfam:Ras 6 168 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207728
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Rab34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Rab34 APN 11 78191438 missense probably damaging 1.00
IGL03180:Rab34 APN 11 78190318 missense probably damaging 1.00
R0190:Rab34 UTSW 11 78191406 missense possibly damaging 0.95
R0465:Rab34 UTSW 11 78190511 nonsense probably null
R1201:Rab34 UTSW 11 78190396 splice site probably null
R1907:Rab34 UTSW 11 78191255 missense probably damaging 1.00
R5564:Rab34 UTSW 11 78191632 missense probably damaging 1.00
R5952:Rab34 UTSW 11 78190268 unclassified probably benign
R6261:Rab34 UTSW 11 78191202 splice site probably null
R7015:Rab34 UTSW 11 78190152 missense probably damaging 1.00
R7127:Rab34 UTSW 11 78191230 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGCTCCAGTCTGGGTGTAG -3'
(R):5'- TCGGATAGCCCCTACGATAAC -3'

Sequencing Primer
(F):5'- CAGTCTGGGTGTAGGCGGTC -3'
(R):5'- TAGCCCCTACGATAACCCGGG -3'
Posted On2015-07-07