Incidental Mutation 'R4411:Abca9'
ID327928
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission 041693-MU
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110151955 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 423 (I423V)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably benign
Transcript: ENSMUST00000044850
AA Change: I423V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: I423V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126499
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6675:Abca9 UTSW 11 110115476 missense probably benign
R6909:Abca9 UTSW 11 110115497 missense probably benign 0.01
R7390:Abca9 UTSW 11 110145661 missense probably benign 0.01
R7429:Abca9 UTSW 11 110127426 frame shift probably null
R7431:Abca9 UTSW 11 110127426 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGGACCGGGGCATTATACAATAC -3'
(R):5'- GGTTTCTAGCAGAACCAAGACC -3'

Sequencing Primer
(F):5'- CCGGGGCATTATACAATACTTTTAC -3'
(R):5'- TAGCAGAACCAAGACCATAATTATCC -3'
Posted On2015-07-07