Incidental Mutation 'R0038:Grin1'
ID32793
Institutional Source Beutler Lab
Gene Symbol Grin1
Ensembl Gene ENSMUSG00000026959
Gene Nameglutamate receptor, ionotropic, NMDA1 (zeta 1)
SynonymsRgsc174, M100174, NR1, GluRzeta1, NMDAR1, Nmdar
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0038 (G1)
Quality Score170
Status Validated (trace)
Chromosome2
Chromosomal Location25291181-25319187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25297459 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 613 (N613S)
Ref Sequence ENSEMBL: ENSMUSP00000109949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028335] [ENSMUST00000114307] [ENSMUST00000114308] [ENSMUST00000114310] [ENSMUST00000114312] [ENSMUST00000114314] [ENSMUST00000114317] [ENSMUST00000114318]
Predicted Effect probably null
Transcript: ENSMUST00000028335
AA Change: N592S

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028335
Gene: ENSMUSG00000026959
AA Change: N592S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 6.6e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.5e-18 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114307
AA Change: N592S

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109946
Gene: ENSMUSG00000026959
AA Change: N592S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114308
AA Change: N613S

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109947
Gene: ENSMUSG00000026959
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114310
AA Change: N613S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109949
Gene: ENSMUSG00000026959
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 39 299 3.6e-24 PFAM
Blast:PBPe 352 420 9e-37 BLAST
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 8.4e-17 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114312
AA Change: N592S

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109951
Gene: ENSMUSG00000026959
AA Change: N592S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 5.9e-35 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 1.4e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114314
AA Change: N592S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109953
Gene: ENSMUSG00000026959
AA Change: N592S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 357 1.1e-34 PFAM
PBPe 433 795 2.71e-97 SMART
Lig_chan-Glu_bd 439 507 2.99e-18 SMART
Pfam:CaM_bdg_C0 835 863 3.3e-19 PFAM
PDB:3BYA|B 875 898 4e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114317
AA Change: N613S

PolyPhen 2 Score 0.653 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109956
Gene: ENSMUSG00000026959
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 7.7e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.3e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114318
AA Change: N613S

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109957
Gene: ENSMUSG00000026959
AA Change: N613S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 38 378 8.4e-31 PFAM
PBPe 454 816 2.71e-97 SMART
Lig_chan-Glu_bd 460 528 2.99e-18 SMART
Pfam:CaM_bdg_C0 856 884 3.4e-19 PFAM
PDB:3BYA|B 896 919 4e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135426
Meta Mutation Damage Score 0.1110 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a critical subunit of N-methyl-D-aspartate receptors, members of the glutamate receptor channel superfamily which are heteromeric protein complexes with multiple subunits arranged to form a ligand-gated ion channel. These subunits play a key role in the plasticity of synapses, which is believed to underlie memory and learning. Cell-specific factors are thought to control expression of different isoforms, possibly contributing to the functional diversity of the subunits. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutants lack whisker patterns in brain cortex, are ataxic and die neonatally of respiratory failure. Hypomorph mutants exhibit hyperactivity, stereotypy, and impaired social/sexual interactions. Mice homozygous for an ENU-induced allele exhibit abnormal behavior and neuron physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Grin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Grin1 APN 2 25296967 missense possibly damaging 0.93
IGL01627:Grin1 APN 2 25318697 missense probably damaging 1.00
IGL02039:Grin1 APN 2 25305342 missense probably damaging 0.98
IGL02074:Grin1 APN 2 25298502 missense possibly damaging 0.81
IGL02083:Grin1 APN 2 25298501 missense possibly damaging 0.93
IGL03334:Grin1 APN 2 25298393 critical splice donor site probably null
IGL03349:Grin1 APN 2 25310436 missense probably benign
PIT4283001:Grin1 UTSW 2 25297852 missense probably damaging 1.00
R0829:Grin1 UTSW 2 25298448 missense probably benign 0.08
R1454:Grin1 UTSW 2 25292430 nonsense probably null
R1550:Grin1 UTSW 2 25305131 missense probably benign 0.01
R1969:Grin1 UTSW 2 25297915 missense probably benign 0.01
R2057:Grin1 UTSW 2 25316820 missense probably damaging 1.00
R2424:Grin1 UTSW 2 25318652 missense probably null 1.00
R2877:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R2878:Grin1 UTSW 2 25297629 missense probably damaging 1.00
R3420:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3422:Grin1 UTSW 2 25303914 missense probably damaging 0.97
R3958:Grin1 UTSW 2 25313453 missense probably damaging 1.00
R4222:Grin1 UTSW 2 25297320 intron probably benign
R4224:Grin1 UTSW 2 25297320 intron probably benign
R4225:Grin1 UTSW 2 25297320 intron probably benign
R4409:Grin1 UTSW 2 25310439 missense possibly damaging 0.75
R4723:Grin1 UTSW 2 25294470 missense probably benign 0.30
R4775:Grin1 UTSW 2 25292463 missense possibly damaging 0.92
R4783:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4784:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4785:Grin1 UTSW 2 25292381 missense possibly damaging 0.86
R4829:Grin1 UTSW 2 25318724 missense possibly damaging 0.47
R4915:Grin1 UTSW 2 25298553 intron probably benign
R5064:Grin1 UTSW 2 25303831 intron probably benign
R5103:Grin1 UTSW 2 25310421 missense probably benign
R5125:Grin1 UTSW 2 25296827 intron probably benign
R5215:Grin1 UTSW 2 25303907 missense probably benign 0.00
R5419:Grin1 UTSW 2 25298273 synonymous probably null
R6119:Grin1 UTSW 2 25305158 missense probably damaging 1.00
R6616:Grin1 UTSW 2 25292110 missense possibly damaging 0.82
R6894:Grin1 UTSW 2 25295817 missense probably damaging 1.00
R7101:Grin1 UTSW 2 25296635 missense probably damaging 0.98
R7137:Grin1 UTSW 2 25313538 missense probably benign
R7544:Grin1 UTSW 2 25305074 missense probably benign 0.05
R7693:Grin1 UTSW 2 25318667 missense possibly damaging 0.93
R7872:Grin1 UTSW 2 25298190 missense probably benign 0.01
R7955:Grin1 UTSW 2 25298190 missense probably benign 0.01
X0026:Grin1 UTSW 2 25305098 missense probably benign 0.22
Z1176:Grin1 UTSW 2 25297907 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTGATGCCTGTGATGCGCTCC -3'
(R):5'- ATGCAGCCCTTTCAGAGCACAC -3'

Sequencing Primer
(F):5'- TTGGCAGTGTAGGAAGCCAC -3'
(R):5'- TTTCAGAGCACACTGTGGC -3'
Posted On2013-05-09