Incidental Mutation 'R4411:Gpc6'
ID327936
Institutional Source Beutler Lab
Gene Symbol Gpc6
Ensembl Gene ENSMUSG00000058571
Gene Nameglypican 6
Synonyms6720429C22Rik
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location116925315-117976544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117951178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 408 (V408A)
Ref Sequence ENSEMBL: ENSMUSP00000120362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078849] [ENSMUST00000088483] [ENSMUST00000125435]
Predicted Effect probably benign
Transcript: ENSMUST00000078849
AA Change: V398A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000077893
Gene: ENSMUSG00000058571
AA Change: V398A

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088483
AA Change: V398A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085835
Gene: ENSMUSG00000058571
AA Change: V398A

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125435
AA Change: V408A

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120362
Gene: ENSMUSG00000058571
AA Change: V408A

DomainStartEndE-ValueType
Pfam:Glypican 15 564 7.2e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183564
Meta Mutation Damage Score 0.3331 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. Mutations in this gene are associated with omodysplasia 1. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, short long bones, small skull, small snout, cleft palate and decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Brd8 C A 18: 34,623,444 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Gpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gpc6 APN 14 117951234 missense probably benign 0.01
IGL00671:Gpc6 APN 14 117186787 missense probably benign 0.01
IGL00928:Gpc6 APN 14 116925958 missense possibly damaging 0.86
IGL01343:Gpc6 APN 14 117186812 missense possibly damaging 0.54
IGL01545:Gpc6 APN 14 117964830 missense probably damaging 1.00
IGL02797:Gpc6 APN 14 116925982 missense probably damaging 0.98
PIT1430001:Gpc6 UTSW 14 117951182 nonsense probably null
R0577:Gpc6 UTSW 14 117436008 missense probably benign 0.03
R0611:Gpc6 UTSW 14 117975018 missense probably null
R0636:Gpc6 UTSW 14 117624493 missense probably benign 0.37
R2152:Gpc6 UTSW 14 116926092 missense probably benign 0.00
R2242:Gpc6 UTSW 14 117186787 missense probably benign 0.01
R2266:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2267:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2269:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R3788:Gpc6 UTSW 14 117624466 missense probably damaging 0.98
R4255:Gpc6 UTSW 14 117951141 missense probably benign 0.15
R4276:Gpc6 UTSW 14 117435916 missense probably damaging 0.99
R4626:Gpc6 UTSW 14 117964843 nonsense probably null
R4993:Gpc6 UTSW 14 117624539 missense possibly damaging 0.93
R5070:Gpc6 UTSW 14 117186769 missense probably benign 0.01
R6007:Gpc6 UTSW 14 117951261 missense probably damaging 1.00
R6058:Gpc6 UTSW 14 117964770 missense probably damaging 1.00
R6488:Gpc6 UTSW 14 117964713 missense possibly damaging 0.73
R6901:Gpc6 UTSW 14 117951217 missense possibly damaging 0.87
R6981:Gpc6 UTSW 14 117624548 missense probably damaging 0.98
R7200:Gpc6 UTSW 14 117964856 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTGGTCCTATAGCATGGATTC -3'
(R):5'- AGAGTCTTGCAGGGTTGAGC -3'

Sequencing Primer
(F):5'- GGTCCTATAGCATGGATTCATTCC -3'
(R):5'- TGCTGTGCCCCATCAGC -3'
Posted On2015-07-07