Mutagenetix > Incidental Mutation

Incidental Mutation 'R4411:C4b'

327941

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

MMRRC Submission

041693-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4411 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34728864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1659 (R1659H)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

probably damaging
Transcript: ENSMUST00000069507
AA Change: R1659H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: R1659H

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173669

Meta Mutation Damage Score

0.7578

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

95% (62/65)

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	C	11: 110,151,955	I423V	probably benign	Het
Abl2	T	C	1: 156,630,082	V306A	possibly damaging	Het
Adcy4	T	C	14: 55,769,443	Y1006C	probably damaging	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Arid5b	T	C	10: 68,096,689	R885G	probably damaging	Het
Atp9a	A	T	2: 168,661,933	V613E	probably damaging	Het
Atxn7l1	G	T	12: 33,194,887		probably benign	Het
Brd8	C	A	18: 34,623,444		probably benign	Het
Bsnd	C	T	4: 106,486,671	R146H	probably benign	Het
Duox1	G	A	2: 122,337,634	R1080H	probably benign	Het
Eml2	T	C	7: 19,182,401		probably null	Het
Fbxo44	G	A	4: 148,153,608	R221C	probably damaging	Het
Frem1	T	C	4: 82,963,244	D166G	probably damaging	Het
Galnt5	T	C	2: 57,999,195	L269P	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Gpc6	T	C	14: 117,951,178	V408A	probably benign	Het
Hspg2	A	G	4: 137,562,224	T3832A	probably benign	Het
Ift88	A	G	14: 57,477,979	N493S	probably damaging	Het
Ighv1-76	A	T	12: 115,848,111	C41S	probably damaging	Het
Igkv12-46	G	A	6: 69,764,946	T16I	probably benign	Het
Igkv3-9	G	T	6: 70,588,563	V49F	probably damaging	Het
Isoc2b	A	T	7: 4,849,434		probably benign	Het
Lcp2	T	A	11: 34,087,173		probably benign	Het
Lmntd1	A	G	6: 145,427,277		probably null	Het
Mdm2	A	T	10: 117,709,789		probably null	Het
Mrgprx3-ps	T	C	7: 47,309,998		noncoding transcript	Het
Msh2	T	C	17: 87,717,604	S637P	probably damaging	Het
Myo5b	T	C	18: 74,698,274	F765S	possibly damaging	Het
Nav2	T	A	7: 49,398,109	N91K	probably benign	Het
Ndor1	G	A	2: 25,248,480	P363S	probably benign	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Pcdhb5	T	C	18: 37,321,997	S477P	possibly damaging	Het
Pde3b	GTGATGATGATGATGATGATGATGATG	GTGATGATGATGATGATGATGATG	7: 114,534,749		probably benign	Het
Pnpla7	G	A	2: 25,051,704	W13*	probably null	Het
Pnpla8	T	C	12: 44,283,442	V41A	probably benign	Het
Prdm2	A	T	4: 143,133,670	S1017T	probably benign	Het
Prdm5	T	A	6: 65,901,787	Y108*	probably null	Het
Rab34	T	A	11: 78,188,766		probably null	Het
Smpd5	G	T	15: 76,294,912	R160L	possibly damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Taf5	T	A	19: 47,071,014	V199D	probably damaging	Het
Tas2r114	C	T	6: 131,689,622	V148I	probably benign	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tex43	A	G	18: 56,594,648	T65A	probably benign	Het
Tnfrsf25	G	A	4: 152,118,386		probably benign	Het
Tpd52l1	T	C	10: 31,379,319	T11A	possibly damaging	Het
Trmt1l	G	A	1: 151,452,154	E472K	probably benign	Het
Ttc17	T	C	2: 94,342,753	K766E	probably damaging	Het
Ttc37	A	G	13: 76,127,504	E410G	possibly damaging	Het
Ttn	C	T	2: 76,730,289	R29256Q	probably damaging	Het
Ttn	T	C	2: 76,742,070	I26160V	probably damaging	Het
Ubxn6	A	T	17: 56,069,303	V311E	probably damaging	Het
Usp2	T	C	9: 44,091,063	S351P	probably damaging	Het
Usp7	C	A	16: 8,708,914	D187Y	probably damaging	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Vmn2r58	T	A	7: 41,861,936	K481M	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Zfp455	A	T	13: 67,207,325	N219I	probably damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5384:C4b	UTSW	17	34737661	missense	possibly damaging	0.89
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GGGTCAGGACATGTACTCAAG -3'
(R):5'- CATTAGGAACCTGGGCTTGCTC -3'

Sequencing Primer
(F):5'- CAGGACATGTACTCAAGGCGTTTG -3'
(R):5'- CTCATAGTGAGCAACAAGTTCTG -3'

Posted On

2015-07-07