Incidental Mutation 'R4411:Brd8'
ID327944
Institutional Source Beutler Lab
Gene Symbol Brd8
Ensembl Gene ENSMUSG00000003778
Gene Namebromodomain containing 8
Synonyms2610007E11Rik, 4432404P07Rik, SMAP, p120
MMRRC Submission 041693-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4411 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34598615-34624601 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 34623444 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003876] [ENSMUST00000097626] [ENSMUST00000115765] [ENSMUST00000115766] [ENSMUST00000166044] [ENSMUST00000167161]
Predicted Effect probably benign
Transcript: ENSMUST00000003876
SMART Domains Protein: ENSMUSP00000003876
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097626
SMART Domains Protein: ENSMUSP00000095229
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 3e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 250 266 N/A INTRINSIC
low complexity region 290 305 N/A INTRINSIC
low complexity region 313 331 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
BROMO 705 813 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115765
SMART Domains Protein: ENSMUSP00000111431
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 5e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 339 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 386 404 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 759 773 N/A INTRINSIC
BROMO 778 886 7.59e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115766
SMART Domains Protein: ENSMUSP00000111432
Gene: ENSMUSG00000003778

DomainStartEndE-ValueType
Blast:SANT 15 74 4e-33 BLAST
coiled coil region 97 132 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 265 282 N/A INTRINSIC
low complexity region 323 337 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
BROMO 708 816 7.59e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153569
Predicted Effect probably benign
Transcript: ENSMUST00000166044
SMART Domains Protein: ENSMUSP00000132659
Gene: ENSMUSG00000003779

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167161
SMART Domains Protein: ENSMUSP00000130045
Gene: ENSMUSG00000003779

DomainStartEndE-ValueType
KISc 61 514 3.95e-141 SMART
coiled coil region 559 760 N/A INTRINSIC
low complexity region 831 842 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 95% (62/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptor in a ligand-dependent manner and enhances thyroid hormone-dependent activation from thyroid response elements. This protein contains a bromodomain and is thought to be a nuclear receptor coactivator. Multiple alternatively spliced transcript variants that encode distinct isoforms have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,151,955 I423V probably benign Het
Abl2 T C 1: 156,630,082 V306A possibly damaging Het
Adcy4 T C 14: 55,769,443 Y1006C probably damaging Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Arid5b T C 10: 68,096,689 R885G probably damaging Het
Atp9a A T 2: 168,661,933 V613E probably damaging Het
Atxn7l1 G T 12: 33,194,887 probably benign Het
Bsnd C T 4: 106,486,671 R146H probably benign Het
C4b C T 17: 34,728,864 R1659H probably damaging Het
Duox1 G A 2: 122,337,634 R1080H probably benign Het
Eml2 T C 7: 19,182,401 probably null Het
Fbxo44 G A 4: 148,153,608 R221C probably damaging Het
Frem1 T C 4: 82,963,244 D166G probably damaging Het
Galnt5 T C 2: 57,999,195 L269P probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpc6 T C 14: 117,951,178 V408A probably benign Het
Hspg2 A G 4: 137,562,224 T3832A probably benign Het
Ift88 A G 14: 57,477,979 N493S probably damaging Het
Ighv1-76 A T 12: 115,848,111 C41S probably damaging Het
Igkv12-46 G A 6: 69,764,946 T16I probably benign Het
Igkv3-9 G T 6: 70,588,563 V49F probably damaging Het
Isoc2b A T 7: 4,849,434 probably benign Het
Lcp2 T A 11: 34,087,173 probably benign Het
Lmntd1 A G 6: 145,427,277 probably null Het
Mdm2 A T 10: 117,709,789 probably null Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Msh2 T C 17: 87,717,604 S637P probably damaging Het
Myo5b T C 18: 74,698,274 F765S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Ndor1 G A 2: 25,248,480 P363S probably benign Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Pcdhb5 T C 18: 37,321,997 S477P possibly damaging Het
Pde3b GTGATGATGATGATGATGATGATGATG GTGATGATGATGATGATGATGATG 7: 114,534,749 probably benign Het
Pnpla7 G A 2: 25,051,704 W13* probably null Het
Pnpla8 T C 12: 44,283,442 V41A probably benign Het
Prdm2 A T 4: 143,133,670 S1017T probably benign Het
Prdm5 T A 6: 65,901,787 Y108* probably null Het
Rab34 T A 11: 78,188,766 probably null Het
Smpd5 G T 15: 76,294,912 R160L possibly damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r114 C T 6: 131,689,622 V148I probably benign Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex43 A G 18: 56,594,648 T65A probably benign Het
Tnfrsf25 G A 4: 152,118,386 probably benign Het
Tpd52l1 T C 10: 31,379,319 T11A possibly damaging Het
Trmt1l G A 1: 151,452,154 E472K probably benign Het
Ttc17 T C 2: 94,342,753 K766E probably damaging Het
Ttc37 A G 13: 76,127,504 E410G possibly damaging Het
Ttn C T 2: 76,730,289 R29256Q probably damaging Het
Ttn T C 2: 76,742,070 I26160V probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp2 T C 9: 44,091,063 S351P probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Zfp455 A T 13: 67,207,325 N219I probably damaging Het
Other mutations in Brd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Brd8 APN 18 34609883 nonsense probably null
IGL01734:Brd8 APN 18 34614805 splice site probably benign
IGL02064:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02065:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02067:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02118:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02120:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02121:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02122:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02123:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02125:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02126:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02160:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02163:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02164:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02166:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02211:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02212:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02216:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02217:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02219:Brd8 APN 18 34602727 missense probably damaging 1.00
IGL02397:Brd8 APN 18 34604873 missense probably damaging 0.99
IGL02642:Brd8 APN 18 34608064 splice site probably benign
IGL02820:Brd8 APN 18 34607301 missense probably benign 0.01
IGL02942:Brd8 APN 18 34610627 missense possibly damaging 0.92
IGL03121:Brd8 APN 18 34606687 missense probably damaging 0.99
IGL03174:Brd8 APN 18 34604909 missense probably damaging 1.00
IGL03304:Brd8 APN 18 34614580 splice site probably benign
R0226:Brd8 UTSW 18 34603894 splice site probably benign
R1269:Brd8 UTSW 18 34609804 critical splice donor site probably null
R1654:Brd8 UTSW 18 34611226 missense probably damaging 1.00
R1692:Brd8 UTSW 18 34609833 missense probably damaging 0.99
R1714:Brd8 UTSW 18 34609833 missense probably damaging 0.99
R1874:Brd8 UTSW 18 34610474 missense probably damaging 1.00
R1965:Brd8 UTSW 18 34602766 missense probably damaging 1.00
R1973:Brd8 UTSW 18 34608013 missense probably damaging 1.00
R2069:Brd8 UTSW 18 34614479 missense probably damaging 1.00
R3952:Brd8 UTSW 18 34614444 splice site probably benign
R4634:Brd8 UTSW 18 34608484 missense possibly damaging 0.78
R4650:Brd8 UTSW 18 34606699 missense probably benign 0.06
R4919:Brd8 UTSW 18 34607436 missense probably damaging 0.99
R4925:Brd8 UTSW 18 34607335 missense probably benign 0.02
R4948:Brd8 UTSW 18 34614532 missense probably damaging 1.00
R5328:Brd8 UTSW 18 34607981 missense probably benign 0.29
R5489:Brd8 UTSW 18 34608645 intron probably null
R5841:Brd8 UTSW 18 34605523 missense probably damaging 1.00
R6306:Brd8 UTSW 18 34611251 missense probably damaging 0.97
R6320:Brd8 UTSW 18 34613239 missense possibly damaging 0.68
R6808:Brd8 UTSW 18 34608475 missense probably damaging 0.98
R7149:Brd8 UTSW 18 34604597 critical splice donor site probably null
R7876:Brd8 UTSW 18 34606687 missense probably benign 0.00
R7959:Brd8 UTSW 18 34606687 missense probably benign 0.00
R8002:Brd8 UTSW 18 34608556 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTAGAGGAAGCCAAATCTAGG -3'
(R):5'- TACTCCACAGTAGTCCTGCC -3'

Sequencing Primer
(F):5'- TTGCACATTCCAGTACTAGGAAGGC -3'
(R):5'- CACAGTAGTCCTGCCTGGGTTG -3'
Posted On2015-07-07