Incidental Mutation 'R4412:Or4c1'
ID 327953
Institutional Source Beutler Lab
Gene Symbol Or4c1
Ensembl Gene ENSMUSG00000075093
Gene Name olfactory receptor family 4 subfamily C member 1
Synonyms MOR235-2, GA_x6K02T2Q125-50748233-50747292, Olfr1231
MMRRC Submission 041135-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R4412 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89132993-89133934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 89133684 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 84 (I84T)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
AlphaFold Q7TQZ8
Predicted Effect probably benign
Transcript: ENSMUST00000099786
AA Change: I84T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: I84T

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
AA Change: I84T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,449,302 (GRCm39) probably benign Het
Adprhl1 T C 8: 13,296,114 (GRCm39) K144E probably benign Het
Alpl A G 4: 137,485,939 (GRCm39) I2T possibly damaging Het
Chdh G T 14: 29,753,672 (GRCm39) G194C probably damaging Het
Cp A T 3: 20,020,517 (GRCm39) D170V probably damaging Het
Cpne9 A G 6: 113,266,962 (GRCm39) K132E possibly damaging Het
Cyp2b9 T G 7: 25,897,868 (GRCm39) L224R probably damaging Het
Dmxl1 A G 18: 49,981,828 (GRCm39) N153S probably benign Het
Dnah17 T C 11: 117,964,509 (GRCm39) Y2423C probably damaging Het
Dnajc14 G T 10: 128,642,074 (GRCm39) probably benign Het
Eipr1 A T 12: 28,909,372 (GRCm39) D213V probably damaging Het
Fat1 T C 8: 45,476,636 (GRCm39) V1894A probably damaging Het
Flrt2 G A 12: 95,747,047 (GRCm39) V462I probably benign Het
Gigyf2 A G 1: 87,364,582 (GRCm39) E954G probably damaging Het
Glis1 A G 4: 107,491,915 (GRCm39) H593R probably damaging Het
Gpr21 C G 2: 37,407,444 (GRCm39) probably benign Het
Gsdmc3 A G 15: 63,738,645 (GRCm39) M139T probably benign Het
Hydin C T 8: 111,142,368 (GRCm39) T749I probably damaging Het
Ilf3 C T 9: 21,310,856 (GRCm39) P620S possibly damaging Het
Khdc3 A G 9: 73,010,156 (GRCm39) T71A possibly damaging Het
Ms4a12 T C 19: 11,207,807 (GRCm39) N33S probably benign Het
Nisch A G 14: 30,908,615 (GRCm39) probably benign Het
Npr2 G A 4: 43,644,150 (GRCm39) C593Y probably damaging Het
Npr3 G C 15: 11,905,235 (GRCm39) T164R probably benign Het
Palld A G 8: 62,140,406 (GRCm39) Y534H probably damaging Het
Pcdhb10 TC T 18: 37,547,194 (GRCm39) probably null Het
Plekhg3 A C 12: 76,624,538 (GRCm39) T1127P probably damaging Het
Podnl1 A T 8: 84,857,294 (GRCm39) H301L probably benign Het
Ripk2 A G 4: 16,124,511 (GRCm39) V399A probably benign Het
Rpp30 T A 19: 36,077,655 (GRCm39) N172K possibly damaging Het
Sin3b C T 8: 73,466,407 (GRCm39) A291V probably benign Het
Slc12a6 A T 2: 112,166,233 (GRCm39) Q204L possibly damaging Het
Snx9 C T 17: 5,958,669 (GRCm39) T249M probably damaging Het
Sohlh2 C A 3: 55,104,423 (GRCm39) T264K probably damaging Het
Srrm2 A G 17: 24,029,442 (GRCm39) probably benign Het
Syne2 T A 12: 76,152,834 (GRCm39) H6674Q probably benign Het
Tyw1 T A 5: 130,364,073 (GRCm39) probably null Het
Vmn1r115 C T 7: 20,578,207 (GRCm39) R235K probably benign Het
Vmn2r50 A C 7: 9,784,235 (GRCm39) F80V probably damaging Het
Yme1l1 G A 2: 23,065,199 (GRCm39) R236H probably damaging Het
Other mutations in Or4c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Or4c1 APN 2 89,133,816 (GRCm39) missense possibly damaging 0.90
IGL02189:Or4c1 APN 2 89,133,641 (GRCm39) missense probably damaging 1.00
IGL02354:Or4c1 APN 2 89,133,526 (GRCm39) missense probably benign 0.03
IGL02361:Or4c1 APN 2 89,133,526 (GRCm39) missense probably benign 0.03
PIT4305001:Or4c1 UTSW 2 89,133,727 (GRCm39) missense probably benign 0.05
R0973:Or4c1 UTSW 2 89,133,528 (GRCm39) missense probably damaging 1.00
R0973:Or4c1 UTSW 2 89,133,528 (GRCm39) missense probably damaging 1.00
R0974:Or4c1 UTSW 2 89,133,528 (GRCm39) missense probably damaging 1.00
R2006:Or4c1 UTSW 2 89,133,160 (GRCm39) missense possibly damaging 0.60
R3150:Or4c1 UTSW 2 89,133,562 (GRCm39) missense possibly damaging 0.82
R3177:Or4c1 UTSW 2 89,133,562 (GRCm39) missense possibly damaging 0.82
R3277:Or4c1 UTSW 2 89,133,562 (GRCm39) missense possibly damaging 0.82
R3409:Or4c1 UTSW 2 89,133,717 (GRCm39) missense probably benign
R4208:Or4c1 UTSW 2 89,133,270 (GRCm39) missense probably damaging 1.00
R4693:Or4c1 UTSW 2 89,133,621 (GRCm39) missense probably benign 0.07
R4697:Or4c1 UTSW 2 89,133,247 (GRCm39) missense probably damaging 1.00
R4697:Or4c1 UTSW 2 89,133,246 (GRCm39) missense possibly damaging 0.90
R5411:Or4c1 UTSW 2 89,133,920 (GRCm39) missense probably benign
R5992:Or4c1 UTSW 2 89,133,703 (GRCm39) missense possibly damaging 0.50
R6894:Or4c1 UTSW 2 89,133,837 (GRCm39) missense probably damaging 1.00
R8017:Or4c1 UTSW 2 89,133,595 (GRCm39) missense possibly damaging 0.94
R8019:Or4c1 UTSW 2 89,133,595 (GRCm39) missense possibly damaging 0.94
R9274:Or4c1 UTSW 2 89,133,513 (GRCm39) missense probably damaging 0.98
R9457:Or4c1 UTSW 2 89,133,075 (GRCm39) missense probably damaging 1.00
X0064:Or4c1 UTSW 2 89,133,246 (GRCm39) missense possibly damaging 0.72
X0067:Or4c1 UTSW 2 89,133,498 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGGCCTTGACGCATAATGGTC -3'
(R):5'- CAGTCCTCCCAGTAATGTGAC -3'

Sequencing Primer
(F):5'- GACGCATAATGGTCATATAATGCAG -3'
(R):5'- TGGGTCTCACACAGAATCCACG -3'
Posted On 2015-07-07