Incidental Mutation 'R4412:Slc12a6'
ID327954
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Namesolute carrier family 12, member 6
Synonymsgaxp, KCC3
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112265825-112363163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112335888 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 204 (Q204L)
Ref Sequence ENSEMBL: ENSMUSP00000124314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028549
AA Change: Q219L

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: Q219L

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053666
AA Change: Q168L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: Q168L

DomainStartEndE-ValueType
Pfam:AA_permease 139 333 2.3e-25 PFAM
Pfam:AA_permease_2 385 668 1.5e-19 PFAM
Pfam:AA_permease 391 710 4.5e-41 PFAM
low complexity region 828 842 N/A INTRINSIC
Pfam:KCl_Cotrans_1 967 996 2.2e-23 PFAM
low complexity region 1079 1091 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110987
AA Change: Q204L

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: Q204L

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110991
AA Change: Q219L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: Q219L

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000141047
AA Change: Q204L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: Q204L

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112353064 splice site probably null
IGL02573:Slc12a6 APN 2 112358641 critical splice donor site probably null
burgess UTSW 2 112347317 missense probably benign 0.09
petrified_forest UTSW 2 112347426 missense probably damaging 1.00
R0548:Slc12a6 UTSW 2 112335924 critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112354190 missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112347426 missense probably damaging 1.00
R1856:Slc12a6 UTSW 2 112335927 splice site probably null
R1958:Slc12a6 UTSW 2 112355158 missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112356485 missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112347317 missense probably benign 0.09
R3888:Slc12a6 UTSW 2 112267030 missense possibly damaging 0.76
R4655:Slc12a6 UTSW 2 112357766 critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112354295 missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112352961 missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112358525 missense probably damaging 1.00
R5016:Slc12a6 UTSW 2 112356627 intron probably benign
R5372:Slc12a6 UTSW 2 112347360 nonsense probably null
R5405:Slc12a6 UTSW 2 112339379 missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112284722 missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112341998 missense possibly damaging 0.62
R6280:Slc12a6 UTSW 2 112337358 missense probably damaging 1.00
R6310:Slc12a6 UTSW 2 112335839 missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112352451 missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112352935 missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112337942 missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112355095 missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112352912 missense probably damaging 0.99
R7188:Slc12a6 UTSW 2 112334415 missense probably benign 0.04
R7395:Slc12a6 UTSW 2 112352542 missense probably damaging 1.00
R7552:Slc12a6 UTSW 2 112341974 missense probably damaging 1.00
R7992:Slc12a6 UTSW 2 112335911 missense probably damaging 1.00
R8016:Slc12a6 UTSW 2 112356554 missense probably benign 0.42
R8122:Slc12a6 UTSW 2 112266822 start codon destroyed probably null
R8192:Slc12a6 UTSW 2 112351377 missense probably damaging 1.00
R8222:Slc12a6 UTSW 2 112339525 splice site probably null
R8534:Slc12a6 UTSW 2 112343967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAACTTCCTGATGACTCTACTTGG -3'
(R):5'- GTCTAATGGGTGCTTAGTGAAAATC -3'

Sequencing Primer
(F):5'- AGAGCACTGACTGTTCTTCCGAAG -3'
(R):5'- ATGGGTGCTTAGTGAAAATCTTTTC -3'
Posted On2015-07-07