Mutagenetix > Incidental Mutation

Incidental Mutation 'R4412:Slc12a6'

327954

Institutional Source

Beutler Lab

Gene Symbol

Slc12a6

Ensembl Gene

ENSMUSG00000027130

Gene Name

solute carrier family 12, member 6

Synonyms

gaxp, KCC3

MMRRC Submission

041135-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R4412 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

112265825-112363163 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112335888 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 204 (Q204L)

Ref Sequence

ENSEMBL: ENSMUSP00000124314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]

AlphaFold

Q924N4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028549
AA Change: Q219L

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: Q219L

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	8e-3	SMART
Pfam:AA_permease	190	384	4.1e-25	PFAM
Pfam:AA_permease	453	761	2.3e-43	PFAM
Pfam:SLC12	773	897	7.1e-20	PFAM
Pfam:SLC12	892	1150	3.9e-32	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053666
AA Change: Q168L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: Q168L

Domain	Start	End	E-Value	Type
Pfam:AA_permease	139	333	2.3e-25	PFAM
Pfam:AA_permease_2	385	668	1.5e-19	PFAM
Pfam:AA_permease	391	710	4.5e-41	PFAM
low complexity region	828	842	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	967	996	2.2e-23	PFAM
low complexity region	1079	1091	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110987
AA Change: Q204L

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: Q204L

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	4e-3	SMART
Pfam:AA_permease	175	369	3.9e-25	PFAM
Pfam:AA_permease_2	421	704	3.2e-19	PFAM
Pfam:AA_permease	426	746	5.8e-41	PFAM
low complexity region	864	878	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110991
AA Change: Q219L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: Q219L

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	7e-3	SMART
Pfam:AA_permease	190	384	4.2e-25	PFAM
Pfam:AA_permease_2	436	719	2.9e-19	PFAM
Pfam:AA_permease	442	761	8.2e-41	PFAM
low complexity region	879	893	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	1018	1047	2.7e-23	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141047
AA Change: Q204L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: Q204L

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	8e-3	SMART
Pfam:AA_permease	175	369	6.6e-25	PFAM
Pfam:AA_permease	438	746	3.6e-43	PFAM
Pfam:SLC12	758	884	6.8e-20	PFAM
Pfam:SLC12	877	1033	5.9e-20	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	C	15: 74,577,453		probably benign	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Alpl	A	G	4: 137,758,628	I2T	possibly damaging	Het
Chdh	G	T	14: 30,031,715	G194C	probably damaging	Het
Cp	A	T	3: 19,966,353	D170V	probably damaging	Het
Cpne9	A	G	6: 113,290,001	K132E	possibly damaging	Het
Cyp2b9	T	G	7: 26,198,443	L224R	probably damaging	Het
Dmxl1	A	G	18: 49,848,761	N153S	probably benign	Het
Dnah17	T	C	11: 118,073,683	Y2423C	probably damaging	Het
Dnajc14	G	T	10: 128,806,205		probably benign	Het
Eipr1	A	T	12: 28,859,373	D213V	probably damaging	Het
Fat1	T	C	8: 45,023,599	V1894A	probably damaging	Het
Flrt2	G	A	12: 95,780,273	V462I	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Glis1	A	G	4: 107,634,718	H593R	probably damaging	Het
Gpr21	C	G	2: 37,517,432		probably benign	Het
Gsdmc3	A	G	15: 63,866,796	M139T	probably benign	Het
Hydin	C	T	8: 110,415,736	T749I	probably damaging	Het
Ilf3	C	T	9: 21,399,560	P620S	possibly damaging	Het
Khdc3	A	G	9: 73,102,874	T71A	possibly damaging	Het
Ms4a12	T	C	19: 11,230,443	N33S	probably benign	Het
Nisch	A	G	14: 31,186,658		probably benign	Het
Npr2	G	A	4: 43,644,150	C593Y	probably damaging	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Olfr1231	A	G	2: 89,303,340	I84T	probably benign	Het
Palld	A	G	8: 61,687,372	Y534H	probably damaging	Het
Pcdhb10	TC	T	18: 37,414,141		probably null	Het
Plekhg3	A	C	12: 76,577,764	T1127P	probably damaging	Het
Podnl1	A	T	8: 84,130,665	H301L	probably benign	Het
Ripk2	A	G	4: 16,124,511	V399A	probably benign	Het
Rpp30	T	A	19: 36,100,255	N172K	possibly damaging	Het
Sin3b	C	T	8: 72,739,779	A291V	probably benign	Het
Snx9	C	T	17: 5,908,394	T249M	probably damaging	Het
Sohlh2	C	A	3: 55,197,002	T264K	probably damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Syne2	T	A	12: 76,106,060	H6674Q	probably benign	Het
Tyw1	T	A	5: 130,335,232		probably null	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Yme1l1	G	A	2: 23,175,187	R236H	probably damaging	Het

Other mutations in Slc12a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01488:Slc12a6	APN	2	112353064	splice site	probably null
IGL02573:Slc12a6	APN	2	112358641	critical splice donor site	probably null
burgess	UTSW	2	112347317	missense	probably benign	0.09
petrified_forest	UTSW	2	112347426	missense	probably damaging	1.00
Prebiotic	UTSW	2	112352935	missense	probably benign	0.30
R0548:Slc12a6	UTSW	2	112335924	critical splice donor site	probably null
R1495:Slc12a6	UTSW	2	112354190	missense	probably damaging	0.99
R1726:Slc12a6	UTSW	2	112347426	missense	probably damaging	1.00
R1856:Slc12a6	UTSW	2	112335927	splice site	probably null
R1958:Slc12a6	UTSW	2	112355158	missense	possibly damaging	0.92
R2112:Slc12a6	UTSW	2	112356485	missense	probably damaging	1.00
R2865:Slc12a6	UTSW	2	112347317	missense	probably benign	0.09
R3888:Slc12a6	UTSW	2	112267030	missense	possibly damaging	0.76
R4655:Slc12a6	UTSW	2	112357766	critical splice acceptor site	probably null
R4669:Slc12a6	UTSW	2	112354295	missense	probably damaging	1.00
R4928:Slc12a6	UTSW	2	112352961	missense	probably damaging	1.00
R4974:Slc12a6	UTSW	2	112358525	missense	probably damaging	1.00
R5016:Slc12a6	UTSW	2	112356627	intron	probably benign
R5372:Slc12a6	UTSW	2	112347360	nonsense	probably null
R5405:Slc12a6	UTSW	2	112339379	missense	probably damaging	1.00
R5786:Slc12a6	UTSW	2	112284722	missense	probably benign	0.01
R5836:Slc12a6	UTSW	2	112341998	missense	possibly damaging	0.62
R6280:Slc12a6	UTSW	2	112337358	missense	probably damaging	1.00
R6310:Slc12a6	UTSW	2	112335839	missense	probably damaging	1.00
R6525:Slc12a6	UTSW	2	112352451	missense	probably damaging	1.00
R6597:Slc12a6	UTSW	2	112352935	missense	probably damaging	1.00
R6723:Slc12a6	UTSW	2	112337942	missense	probably damaging	1.00
R6895:Slc12a6	UTSW	2	112355095	missense	probably damaging	1.00
R7059:Slc12a6	UTSW	2	112352912	missense	probably damaging	0.99
R7188:Slc12a6	UTSW	2	112334415	missense	probably benign	0.04
R7395:Slc12a6	UTSW	2	112352542	missense	probably damaging	1.00
R7552:Slc12a6	UTSW	2	112341974	missense	probably damaging	1.00
R7992:Slc12a6	UTSW	2	112335911	missense	probably damaging	1.00
R8016:Slc12a6	UTSW	2	112356554	missense	probably benign	0.42
R8122:Slc12a6	UTSW	2	112266822	start codon destroyed	probably null
R8192:Slc12a6	UTSW	2	112351377	missense	probably damaging	1.00
R8222:Slc12a6	UTSW	2	112339525	splice site	probably null
R8534:Slc12a6	UTSW	2	112343967	missense	probably damaging	1.00
R9018:Slc12a6	UTSW	2	112344240	splice site	probably benign
R9281:Slc12a6	UTSW	2	112334409	missense	probably benign	0.00
R9418:Slc12a6	UTSW	2	112344210	missense
R9448:Slc12a6	UTSW	2	112349359	missense	probably damaging	1.00
R9460:Slc12a6	UTSW	2	112352935	missense	probably benign	0.30
R9694:Slc12a6	UTSW	2	112344536	missense	probably damaging	1.00
R9712:Slc12a6	UTSW	2	112356472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAACTTCCTGATGACTCTACTTGG -3'
(R):5'- GTCTAATGGGTGCTTAGTGAAAATC -3'

Sequencing Primer
(F):5'- AGAGCACTGACTGTTCTTCCGAAG -3'
(R):5'- ATGGGTGCTTAGTGAAAATCTTTTC -3'

Posted On

2015-07-07