Incidental Mutation 'R4412:Sohlh2'
ID327956
Institutional Source Beutler Lab
Gene Symbol Sohlh2
Ensembl Gene ENSMUSG00000027794
Gene Namespermatogenesis and oogenesis specific basic helix-loop-helix 2
Synonyms4933406N12Rik
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.597) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location55182028-55209957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55197002 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 264 (T264K)
Ref Sequence ENSEMBL: ENSMUSP00000029369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029369]
Predicted Effect probably damaging
Transcript: ENSMUST00000029369
AA Change: T264K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029369
Gene: ENSMUSG00000027794
AA Change: T264K

DomainStartEndE-ValueType
HLH 206 257 4.2e-8 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 449 461 N/A INTRINSIC
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the neighboring C13orf38 (chromosome 13 open reading frame 38) and SOHLH2 (spermatogenesis and oogenesis specific basic helix-loop-helix 2) genes. The read-through transcript encodes a fusion protein that shares sequence identity with the products of each individual gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to female and male infertility due to defects in early oocyte and spermatogonial differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Sohlh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sohlh2 APN 3 55207815 missense probably damaging 1.00
IGL00574:Sohlh2 APN 3 55204326 splice site probably benign
IGL01434:Sohlh2 APN 3 55195161 missense probably damaging 1.00
IGL02200:Sohlh2 APN 3 55190556 missense probably damaging 1.00
G1citation:Sohlh2 UTSW 3 55207686 missense probably damaging 1.00
R0362:Sohlh2 UTSW 3 55207742 missense probably damaging 1.00
R0540:Sohlh2 UTSW 3 55207683 missense probably damaging 0.99
R0607:Sohlh2 UTSW 3 55207683 missense probably damaging 0.99
R0732:Sohlh2 UTSW 3 55190373 critical splice donor site probably null
R1878:Sohlh2 UTSW 3 55207643 missense probably damaging 0.97
R2001:Sohlh2 UTSW 3 55192341 splice site probably null
R2070:Sohlh2 UTSW 3 55207622 missense probably benign 0.18
R2071:Sohlh2 UTSW 3 55207622 missense probably benign 0.18
R4413:Sohlh2 UTSW 3 55197002 missense probably damaging 1.00
R4714:Sohlh2 UTSW 3 55190529 missense probably benign 0.00
R5709:Sohlh2 UTSW 3 55192302 missense probably benign 0.03
R5818:Sohlh2 UTSW 3 55190501 missense probably damaging 1.00
R6173:Sohlh2 UTSW 3 55196998 missense probably benign 0.26
R6822:Sohlh2 UTSW 3 55207686 missense probably damaging 1.00
R6850:Sohlh2 UTSW 3 55192286 missense probably benign 0.05
X0023:Sohlh2 UTSW 3 55196776 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTTGATTATGTGAAGCAGGTCC -3'
(R):5'- TGATCAGAACTGGCAGTGGG -3'

Sequencing Primer
(F):5'- AGGTCCGGGAGTCTCTCTCTC -3'
(R):5'- GGAGACAGTCGTGAATCCCTAAC -3'
Posted On2015-07-07