Incidental Mutation 'R4412:Ripk2'
ID 327957
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Name receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms 2210420D18Rik, D4Bwg0615e, CARDIAK, RICK, CCK, CARD3, RIP2
MMRRC Submission 041135-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.306) question?
Stock # R4412 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 16122733-16163647 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 16124511 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 399 (V399A)
Ref Sequence ENSEMBL: ENSMUSP00000038833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
AlphaFold P58801
Predicted Effect probably benign
Transcript: ENSMUST00000037035
AA Change: V399A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135
AA Change: V399A

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117437
Predicted Effect probably benign
Transcript: ENSMUST00000183871
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,449,302 (GRCm39) probably benign Het
Adprhl1 T C 8: 13,296,114 (GRCm39) K144E probably benign Het
Alpl A G 4: 137,485,939 (GRCm39) I2T possibly damaging Het
Chdh G T 14: 29,753,672 (GRCm39) G194C probably damaging Het
Cp A T 3: 20,020,517 (GRCm39) D170V probably damaging Het
Cpne9 A G 6: 113,266,962 (GRCm39) K132E possibly damaging Het
Cyp2b9 T G 7: 25,897,868 (GRCm39) L224R probably damaging Het
Dmxl1 A G 18: 49,981,828 (GRCm39) N153S probably benign Het
Dnah17 T C 11: 117,964,509 (GRCm39) Y2423C probably damaging Het
Dnajc14 G T 10: 128,642,074 (GRCm39) probably benign Het
Eipr1 A T 12: 28,909,372 (GRCm39) D213V probably damaging Het
Fat1 T C 8: 45,476,636 (GRCm39) V1894A probably damaging Het
Flrt2 G A 12: 95,747,047 (GRCm39) V462I probably benign Het
Gigyf2 A G 1: 87,364,582 (GRCm39) E954G probably damaging Het
Glis1 A G 4: 107,491,915 (GRCm39) H593R probably damaging Het
Gpr21 C G 2: 37,407,444 (GRCm39) probably benign Het
Gsdmc3 A G 15: 63,738,645 (GRCm39) M139T probably benign Het
Hydin C T 8: 111,142,368 (GRCm39) T749I probably damaging Het
Ilf3 C T 9: 21,310,856 (GRCm39) P620S possibly damaging Het
Khdc3 A G 9: 73,010,156 (GRCm39) T71A possibly damaging Het
Ms4a12 T C 19: 11,207,807 (GRCm39) N33S probably benign Het
Nisch A G 14: 30,908,615 (GRCm39) probably benign Het
Npr2 G A 4: 43,644,150 (GRCm39) C593Y probably damaging Het
Npr3 G C 15: 11,905,235 (GRCm39) T164R probably benign Het
Or4c1 A G 2: 89,133,684 (GRCm39) I84T probably benign Het
Palld A G 8: 62,140,406 (GRCm39) Y534H probably damaging Het
Pcdhb10 TC T 18: 37,547,194 (GRCm39) probably null Het
Plekhg3 A C 12: 76,624,538 (GRCm39) T1127P probably damaging Het
Podnl1 A T 8: 84,857,294 (GRCm39) H301L probably benign Het
Rpp30 T A 19: 36,077,655 (GRCm39) N172K possibly damaging Het
Sin3b C T 8: 73,466,407 (GRCm39) A291V probably benign Het
Slc12a6 A T 2: 112,166,233 (GRCm39) Q204L possibly damaging Het
Snx9 C T 17: 5,958,669 (GRCm39) T249M probably damaging Het
Sohlh2 C A 3: 55,104,423 (GRCm39) T264K probably damaging Het
Srrm2 A G 17: 24,029,442 (GRCm39) probably benign Het
Syne2 T A 12: 76,152,834 (GRCm39) H6674Q probably benign Het
Tyw1 T A 5: 130,364,073 (GRCm39) probably null Het
Vmn1r115 C T 7: 20,578,207 (GRCm39) R235K probably benign Het
Vmn2r50 A C 7: 9,784,235 (GRCm39) F80V probably damaging Het
Yme1l1 G A 2: 23,065,199 (GRCm39) R236H probably damaging Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16,139,198 (GRCm39) splice site probably benign
IGL01346:Ripk2 APN 4 16,132,775 (GRCm39) critical splice donor site probably null
IGL01631:Ripk2 APN 4 16,163,342 (GRCm39) missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16,139,240 (GRCm39) missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16,152,056 (GRCm39) missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16,123,868 (GRCm39) nonsense probably null
R0066:Ripk2 UTSW 4 16,123,868 (GRCm39) nonsense probably null
R0189:Ripk2 UTSW 4 16,129,125 (GRCm39) splice site probably null
R1454:Ripk2 UTSW 4 16,163,239 (GRCm39) missense probably damaging 0.96
R1715:Ripk2 UTSW 4 16,155,192 (GRCm39) critical splice acceptor site probably null
R2153:Ripk2 UTSW 4 16,132,775 (GRCm39) critical splice donor site probably null
R2266:Ripk2 UTSW 4 16,152,011 (GRCm39) missense possibly damaging 0.91
R2394:Ripk2 UTSW 4 16,132,774 (GRCm39) splice site probably benign
R3693:Ripk2 UTSW 4 16,127,695 (GRCm39) missense probably benign
R4463:Ripk2 UTSW 4 16,151,968 (GRCm39) missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16,155,073 (GRCm39) missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16,127,663 (GRCm39) missense possibly damaging 0.78
R5453:Ripk2 UTSW 4 16,151,989 (GRCm39) missense probably damaging 1.00
R6197:Ripk2 UTSW 4 16,163,330 (GRCm39) missense probably damaging 1.00
R6576:Ripk2 UTSW 4 16,131,558 (GRCm39) splice site probably null
R6967:Ripk2 UTSW 4 16,158,275 (GRCm39) critical splice donor site probably null
R7351:Ripk2 UTSW 4 16,155,048 (GRCm39) missense probably damaging 1.00
R7479:Ripk2 UTSW 4 16,155,154 (GRCm39) missense probably benign 0.02
R7718:Ripk2 UTSW 4 16,151,968 (GRCm39) missense possibly damaging 0.70
R8188:Ripk2 UTSW 4 16,139,218 (GRCm39) missense probably damaging 1.00
R8242:Ripk2 UTSW 4 16,124,430 (GRCm39) missense probably benign 0.00
R8509:Ripk2 UTSW 4 16,124,436 (GRCm39) missense probably benign
R8700:Ripk2 UTSW 4 16,158,422 (GRCm39) missense possibly damaging 0.91
R8987:Ripk2 UTSW 4 16,123,699 (GRCm39) missense possibly damaging 0.72
R9084:Ripk2 UTSW 4 16,123,795 (GRCm39) missense probably damaging 1.00
R9202:Ripk2 UTSW 4 16,124,502 (GRCm39) missense probably benign
R9369:Ripk2 UTSW 4 16,127,651 (GRCm39) missense probably benign 0.01
R9469:Ripk2 UTSW 4 16,138,181 (GRCm39) missense possibly damaging 0.73
Z1176:Ripk2 UTSW 4 16,151,943 (GRCm39) missense probably damaging 1.00
Z1177:Ripk2 UTSW 4 16,163,331 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGAGTCTGGAAATGCTCTC -3'
(R):5'- AGAACCAAAGCCGTTAGAGC -3'

Sequencing Primer
(F):5'- GTCTGGAAATGCTCTCCTACTTAAAC -3'
(R):5'- AAAGCCGTTAGAGCCTACCTTCTG -3'
Posted On 2015-07-07