Incidental Mutation 'R4412:Ripk2'
ID327957
Institutional Source Beutler Lab
Gene Symbol Ripk2
Ensembl Gene ENSMUSG00000041135
Gene Namereceptor (TNFRSF)-interacting serine-threonine kinase 2
SynonymsCCK, RICK, CARD3, D4Bwg0615e, 2210420D18Rik, RIP2, CARDIAK
MMRRC Submission 041135-MU
Accession Numbers

Ncbi RefSeq: NM_138952.3; MGI:1891456

Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location16122733-16163647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16124511 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 399 (V399A)
Ref Sequence ENSEMBL: ENSMUSP00000038833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037035] [ENSMUST00000183871]
Predicted Effect probably benign
Transcript: ENSMUST00000037035
AA Change: V399A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038833
Gene: ENSMUSG00000041135
AA Change: V399A

DomainStartEndE-ValueType
Pfam:Pkinase 18 289 2.1e-43 PFAM
Pfam:Pkinase_Tyr 18 290 1.1e-45 PFAM
CARD 434 522 2.34e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117437
Predicted Effect probably benign
Transcript: ENSMUST00000183871
SMART Domains Protein: ENSMUSP00000139381
Gene: ENSMUSG00000041135

DomainStartEndE-ValueType
Pfam:Pkinase 18 290 5.6e-46 PFAM
Pfam:Pkinase_Tyr 18 290 1.2e-44 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 3622328; 2660793;2446070
FUNCTION: This gene encodes a member of the receptor-interacting protein family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain, and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of nuclear factor kappa B and inducer of apoptosis in response to various stimuli. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to impaired cytokine production in response to LPS treatment, and may result in resistance to LPS-induced septic shock and defects in Toll-like receptor and T-cell receptor signaling. Macrophages homozygous for a knock-in allele show normal LPS signaling. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(5) Gene trapped(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Ripk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Ripk2 APN 4 16139198 splice site probably benign
IGL01346:Ripk2 APN 4 16132775 critical splice donor site probably null
IGL01631:Ripk2 APN 4 16163342 missense possibly damaging 0.83
IGL02151:Ripk2 APN 4 16139240 missense possibly damaging 0.83
IGL03093:Ripk2 APN 4 16152056 missense probably damaging 1.00
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0066:Ripk2 UTSW 4 16123868 nonsense probably null
R0189:Ripk2 UTSW 4 16129125 splice site probably null
R1454:Ripk2 UTSW 4 16163239 missense probably damaging 0.96
R1715:Ripk2 UTSW 4 16155192 critical splice acceptor site probably null
R2153:Ripk2 UTSW 4 16132775 critical splice donor site probably null
R2266:Ripk2 UTSW 4 16152011 missense possibly damaging 0.91
R2394:Ripk2 UTSW 4 16132774 splice site probably benign
R3693:Ripk2 UTSW 4 16127695 missense probably benign
R4463:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R4843:Ripk2 UTSW 4 16155073 missense probably damaging 0.99
R5085:Ripk2 UTSW 4 16127663 missense possibly damaging 0.78
R5453:Ripk2 UTSW 4 16151989 missense probably damaging 1.00
R6197:Ripk2 UTSW 4 16163330 missense probably damaging 1.00
R6576:Ripk2 UTSW 4 16131558 splice site probably null
R6967:Ripk2 UTSW 4 16158275 critical splice donor site probably null
R7351:Ripk2 UTSW 4 16155048 missense probably damaging 1.00
R7479:Ripk2 UTSW 4 16155154 missense probably benign 0.02
R7718:Ripk2 UTSW 4 16151968 missense possibly damaging 0.70
R8188:Ripk2 UTSW 4 16139218 missense probably damaging 1.00
R8242:Ripk2 UTSW 4 16124430 missense probably benign 0.00
R8509:Ripk2 UTSW 4 16124436 missense probably benign
R8700:Ripk2 UTSW 4 16158422 missense possibly damaging 0.91
Z1176:Ripk2 UTSW 4 16151943 missense probably damaging 1.00
Z1177:Ripk2 UTSW 4 16163331 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACTGAGTCTGGAAATGCTCTC -3'
(R):5'- AGAACCAAAGCCGTTAGAGC -3'

Sequencing Primer
(F):5'- GTCTGGAAATGCTCTCCTACTTAAAC -3'
(R):5'- AAAGCCGTTAGAGCCTACCTTCTG -3'
Posted On2015-07-07