Incidental Mutation 'R4412:Glis1'
ID327959
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene NameGLIS family zinc finger 1
SynonymsGliH1
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4412 (G1)
Quality Score176
Status Not validated
Chromosome4
Chromosomal Location107434591-107635061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107634718 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 593 (H593R)
Ref Sequence ENSEMBL: ENSMUSP00000102349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
Predicted Effect probably damaging
Transcript: ENSMUST00000046005
AA Change: H781R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: H781R

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106738
AA Change: H593R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: H593R

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125573
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107627561 missense probably benign 0.01
IGL02450:Glis1 APN 4 107627529 missense probably benign 0.25
IGL03167:Glis1 APN 4 107435905 missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107615051 missense probably damaging 1.00
IGL03377:Glis1 APN 4 107632281 missense probably damaging 0.98
glenys UTSW 4 107627543 missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107568119 splice site probably null
R0981:Glis1 UTSW 4 107615042 missense probably damaging 1.00
R1036:Glis1 UTSW 4 107632264 missense probably benign 0.05
R1527:Glis1 UTSW 4 107567926 missense probably damaging 0.96
R1741:Glis1 UTSW 4 107568347 missense probably damaging 1.00
R2937:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107632291 missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107567845 missense probably benign 0.01
R4587:Glis1 UTSW 4 107627543 missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107567645 missense probably benign 0.00
R4900:Glis1 UTSW 4 107619564 missense probably damaging 1.00
R5138:Glis1 UTSW 4 107623105 frame shift probably null
R5167:Glis1 UTSW 4 107634694 missense probably damaging 1.00
R5511:Glis1 UTSW 4 107435877 missense probably damaging 0.99
R5568:Glis1 UTSW 4 107619635 missense probably damaging 0.99
R5807:Glis1 UTSW 4 107568082 missense probably benign 0.00
R6006:Glis1 UTSW 4 107567906 missense probably damaging 1.00
R6180:Glis1 UTSW 4 107627513 missense probably benign 0.06
R6219:Glis1 UTSW 4 107631905 missense probably benign 0.27
R6856:Glis1 UTSW 4 107435879 missense probably damaging 0.96
R7278:Glis1 UTSW 4 107435683 start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107634703 missense probably damaging 1.00
R7937:Glis1 UTSW 4 107627526 missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107632374 missense probably damaging 1.00
R7940:Glis1 UTSW 4 107632375 missense probably damaging 0.99
R7954:Glis1 UTSW 4 107619657 missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107567902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCAGTCTGCCTGTCTTC -3'
(R):5'- CGAGGTCTGTGATTTGAGAACC -3'

Sequencing Primer
(F):5'- TTTGGAGTGCAAGACCCC -3'
(R):5'- ATAGCTCCTGGCAGGCAG -3'
Posted On2015-07-07