Incidental Mutation 'R4412:Tyw1'
ID327961
Institutional Source Beutler Lab
Gene Symbol Tyw1
Ensembl Gene ENSMUSG00000056310
Gene NametRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
SynonymsRsafd1
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location130255619-130341563 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 130335232 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040213]
Predicted Effect probably null
Transcript: ENSMUST00000040213
SMART Domains Protein: ENSMUSP00000037173
Gene: ENSMUSG00000056310

DomainStartEndE-ValueType
transmembrane domain 20 39 N/A INTRINSIC
Pfam:Flavodoxin_1 73 224 1.6e-27 PFAM
low complexity region 276 288 N/A INTRINSIC
Pfam:Radical_SAM 399 581 1.1e-29 PFAM
Pfam:Wyosine_form 583 646 3.6e-29 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Wybutosine (yW) is a hypermodified guanosine found in phenylalanine tRNA adjacent to the anticodon that stabilizes codon-anticodon interactions in the ribosome. In yeast, the homolog of this gene is essential for the synthesis of wybutosine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Tyw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02329:Tyw1 APN 5 130267080 missense probably benign 0.20
IGL02873:Tyw1 APN 5 130335330 missense probably benign 0.00
IGL02879:Tyw1 APN 5 130296771 missense probably damaging 1.00
IGL03080:Tyw1 APN 5 130267055 missense probably damaging 1.00
IGL03291:Tyw1 APN 5 130299993 missense probably damaging 1.00
IGL03297:Tyw1 APN 5 130340734 missense probably damaging 1.00
R1420:Tyw1 UTSW 5 130274745 critical splice donor site probably null
R1650:Tyw1 UTSW 5 130288911 missense possibly damaging 0.91
R1674:Tyw1 UTSW 5 130269328 missense probably benign 0.01
R1789:Tyw1 UTSW 5 130258993 missense probably damaging 0.99
R1996:Tyw1 UTSW 5 130262811 splice site probably benign
R2421:Tyw1 UTSW 5 130269260 missense probably damaging 1.00
R3913:Tyw1 UTSW 5 130259035 missense probably damaging 0.98
R4835:Tyw1 UTSW 5 130277058 missense probably benign
R5058:Tyw1 UTSW 5 130277086 missense probably benign 0.03
R5190:Tyw1 UTSW 5 130267915 nonsense probably null
R5398:Tyw1 UTSW 5 130277157 intron probably benign
R5459:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R5597:Tyw1 UTSW 5 130274657 missense probably benign 0.00
R5704:Tyw1 UTSW 5 130282022 nonsense probably null
R5825:Tyw1 UTSW 5 130268088 missense probably damaging 0.99
R5887:Tyw1 UTSW 5 130325699 missense probably damaging 1.00
R6072:Tyw1 UTSW 5 130267911 missense possibly damaging 0.92
R6349:Tyw1 UTSW 5 130277031 missense possibly damaging 0.82
R6366:Tyw1 UTSW 5 130281951 unclassified probably benign
R7012:Tyw1 UTSW 5 130277730 splice site probably null
R7259:Tyw1 UTSW 5 130267872 splice site probably null
R7328:Tyw1 UTSW 5 130262844 missense probably benign 0.08
R7555:Tyw1 UTSW 5 130274706 missense probably damaging 1.00
R8006:Tyw1 UTSW 5 130268072 missense possibly damaging 0.87
R8171:Tyw1 UTSW 5 130300014 missense probably benign 0.19
R8196:Tyw1 UTSW 5 130300021 missense probably damaging 1.00
R8714:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8715:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
R8716:Tyw1 UTSW 5 130269224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGACAAACTCGCTATCTC -3'
(R):5'- ACCTTCTTGTGTCCGATCAG -3'

Sequencing Primer
(F):5'- GAAAGGCTCACATCATTCTTGGGC -3'
(R):5'- TCCGATCAGGAGGCAGTTG -3'
Posted On2015-07-07