Incidental Mutation 'R4412:Cpne9'
ID327962
Institutional Source Beutler Lab
Gene Symbol Cpne9
Ensembl Gene ENSMUSG00000030270
Gene Namecopine family member IX
Synonyms
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113282307-113305627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113290001 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 132 (K132E)
Ref Sequence ENSEMBL: ENSMUSP00000044416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000130191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041203
AA Change: K132E

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270
AA Change: K132E

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204050
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Cpne9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cpne9 APN 6 113293022 missense possibly damaging 0.54
IGL02318:Cpne9 APN 6 113293738 missense possibly damaging 0.74
IGL02800:Cpne9 APN 6 113302073 missense probably benign 0.40
IGL02819:Cpne9 APN 6 113300663 missense probably damaging 0.99
IGL03111:Cpne9 APN 6 113300610 missense possibly damaging 0.79
measured UTSW 6 113290013 missense probably damaging 0.98
prudence UTSW 6 113284445 missense possibly damaging 0.69
PIT4366001:Cpne9 UTSW 6 113294746 missense probably damaging 1.00
R0145:Cpne9 UTSW 6 113300601 missense probably damaging 0.97
R0319:Cpne9 UTSW 6 113294693 missense probably damaging 1.00
R0514:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R0586:Cpne9 UTSW 6 113295063 missense probably damaging 0.96
R0594:Cpne9 UTSW 6 113290400 splice site probably benign
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R4184:Cpne9 UTSW 6 113282457 unclassified probably benign
R4243:Cpne9 UTSW 6 113283023 unclassified probably benign
R4256:Cpne9 UTSW 6 113283023 unclassified probably benign
R4258:Cpne9 UTSW 6 113283023 unclassified probably benign
R4690:Cpne9 UTSW 6 113302055 missense probably damaging 1.00
R5062:Cpne9 UTSW 6 113304488 missense probably damaging 0.99
R5249:Cpne9 UTSW 6 113293073 splice site probably benign
R5437:Cpne9 UTSW 6 113304630 unclassified probably benign
R5523:Cpne9 UTSW 6 113290231 missense probably damaging 1.00
R5979:Cpne9 UTSW 6 113293749 missense probably benign 0.44
R6207:Cpne9 UTSW 6 113294773 missense possibly damaging 0.88
R6849:Cpne9 UTSW 6 113302118 missense probably damaging 0.98
R6989:Cpne9 UTSW 6 113300583 missense possibly damaging 0.95
R7376:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R7524:Cpne9 UTSW 6 113302064 missense probably damaging 1.00
R7631:Cpne9 UTSW 6 113302118 missense possibly damaging 0.72
R7689:Cpne9 UTSW 6 113290004 missense probably damaging 1.00
R7757:Cpne9 UTSW 6 113284445 missense possibly damaging 0.69
R8134:Cpne9 UTSW 6 113295042 missense probably benign 0.16
R8418:Cpne9 UTSW 6 113283437 missense possibly damaging 0.95
R8810:Cpne9 UTSW 6 113304545 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTTTCTCACCAAGAGCC -3'
(R):5'- AGGAAAGGGTCTGACTTCCC -3'

Sequencing Primer
(F):5'- GCCTCTCCGAATAGAAGTGG -3'
(R):5'- TTTGCACACAGCTGCATGG -3'
Posted On2015-07-07