Incidental Mutation 'R4412:Sin3b'
ID327970
Institutional Source Beutler Lab
Gene Symbol Sin3b
Ensembl Gene ENSMUSG00000031622
Gene Nametranscriptional regulator, SIN3B (yeast)
Synonyms2810430C10Rik
MMRRC Submission 041135-MU
Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72723285-72758201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72739779 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 291 (A291V)
Ref Sequence ENSEMBL: ENSMUSP00000105576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004494] [ENSMUST00000109950] [ENSMUST00000212095]
Predicted Effect probably benign
Transcript: ENSMUST00000004494
SMART Domains Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 2.5e-19 PFAM
Pfam:PAH 173 227 4.4e-20 PFAM
Pfam:PAH 313 357 1.6e-8 PFAM
HDAC_interact 384 484 2.75e-58 SMART
low complexity region 667 688 N/A INTRINSIC
Pfam:Sin3a_C 712 1011 7.2e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109950
AA Change: A291V

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105576
Gene: ENSMUSG00000031622
AA Change: A291V

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:PAH 53 97 3.4e-20 PFAM
Pfam:PAH 173 227 5.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213079
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Sin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Sin3b APN 8 72757000 missense probably benign 0.22
IGL01107:Sin3b APN 8 72731105 missense possibly damaging 0.74
IGL01114:Sin3b APN 8 72744505 missense probably benign 0.06
IGL01603:Sin3b APN 8 72750064 missense probably damaging 1.00
IGL01763:Sin3b APN 8 72746608 missense probably damaging 1.00
IGL02078:Sin3b APN 8 72753580 missense possibly damaging 0.49
IGL02572:Sin3b APN 8 72744481 missense probably benign 0.15
IGL02732:Sin3b APN 8 72733453 missense possibly damaging 0.72
IGL02831:Sin3b APN 8 72744562 missense probably damaging 1.00
IGL03064:Sin3b APN 8 72757058 unclassified probably benign
IGL03107:Sin3b APN 8 72753585 missense probably damaging 0.99
IGL03142:Sin3b APN 8 72744568 missense probably damaging 1.00
3-1:Sin3b UTSW 8 72753209 missense possibly damaging 0.95
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0070:Sin3b UTSW 8 72725582 missense probably damaging 1.00
R0226:Sin3b UTSW 8 72744508 missense probably benign 0.44
R0629:Sin3b UTSW 8 72753536 splice site probably benign
R1486:Sin3b UTSW 8 72750513 missense probably benign 0.00
R1524:Sin3b UTSW 8 72753287 missense probably benign 0.05
R1653:Sin3b UTSW 8 72741519 missense probably benign 0.30
R2144:Sin3b UTSW 8 72731265 missense probably damaging 1.00
R2180:Sin3b UTSW 8 72753295 nonsense probably null
R2271:Sin3b UTSW 8 72733419 missense probably benign 0.11
R2353:Sin3b UTSW 8 72724152 critical splice donor site probably null
R3945:Sin3b UTSW 8 72733439 missense possibly damaging 0.88
R4564:Sin3b UTSW 8 72753581 missense probably damaging 1.00
R4782:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4799:Sin3b UTSW 8 72725643 missense probably benign 0.04
R4863:Sin3b UTSW 8 72744948 missense possibly damaging 0.91
R5011:Sin3b UTSW 8 72744556 missense probably benign 0.39
R5237:Sin3b UTSW 8 72733343 critical splice acceptor site probably null
R5325:Sin3b UTSW 8 72750526 missense probably damaging 1.00
R5725:Sin3b UTSW 8 72725692 critical splice donor site probably null
R5927:Sin3b UTSW 8 72749878 missense probably benign 0.00
R5945:Sin3b UTSW 8 72731165 missense probably damaging 0.97
R6492:Sin3b UTSW 8 72733490 critical splice donor site probably null
R7092:Sin3b UTSW 8 72747870 critical splice donor site probably null
R7106:Sin3b UTSW 8 72724137 missense possibly damaging 0.90
R7258:Sin3b UTSW 8 72750208 missense probably benign 0.00
R7472:Sin3b UTSW 8 72753225 missense probably damaging 1.00
R7475:Sin3b UTSW 8 72749872 missense possibly damaging 0.47
R7491:Sin3b UTSW 8 72746441 missense probably damaging 1.00
R7636:Sin3b UTSW 8 72747734 nonsense probably null
R8063:Sin3b UTSW 8 72725541 missense probably damaging 1.00
R8354:Sin3b UTSW 8 72741480 missense probably benign
R8454:Sin3b UTSW 8 72741480 missense probably benign
R8711:Sin3b UTSW 8 72723398 missense probably damaging 0.97
R8719:Sin3b UTSW 8 72723511 missense unknown
R8807:Sin3b UTSW 8 72750080 missense probably benign 0.00
X0017:Sin3b UTSW 8 72731165 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTAGGAAAGCACCATCTCCTG -3'
(R):5'- CAGGACAGTTTGGGTGTCAAG -3'

Sequencing Primer
(F):5'- TGCTGACCTGGCCATCAC -3'
(R):5'- ACAGTTTGGGTGTCAAGATACC -3'
Posted On2015-07-07