Incidental Mutation 'R4412:Podnl1'
ID327971
Institutional Source Beutler Lab
Gene Symbol Podnl1
Ensembl Gene ENSMUSG00000012889
Gene Namepodocan-like 1
Synonyms
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4412 (G1)
Quality Score208
Status Not validated
Chromosome8
Chromosomal Location84125989-84132527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84130665 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 301 (H301L)
Ref Sequence ENSEMBL: ENSMUSP00000091073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000093380] [ENSMUST00000117424]
Predicted Effect probably benign
Transcript: ENSMUST00000040383
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093380
AA Change: H301L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091073
Gene: ENSMUSG00000012889
AA Change: H301L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 38 71 1.91e0 SMART
LRR 70 89 1.81e2 SMART
LRR 90 115 1.76e-1 SMART
LRR 116 139 1.19e2 SMART
LRR 162 186 1.06e1 SMART
LRR 191 210 5.42e1 SMART
LRR 211 231 1.66e1 SMART
LRR 233 257 3.98e1 SMART
LRR_TYP 258 281 7.9e-4 SMART
LRR 304 328 9.24e1 SMART
LRR_TYP 329 352 4.72e-2 SMART
LRR 375 399 2.61e2 SMART
LRR_TYP 400 423 2.61e-4 SMART
LRR 424 444 3.18e1 SMART
LRR 445 470 3.27e1 SMART
LRR_TYP 471 494 3.63e-3 SMART
LRR 495 515 1.97e1 SMART
LRR 516 541 2.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117424
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154029
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Podnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Podnl1 APN 8 84132195 missense probably benign 0.31
IGL03151:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03197:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03198:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03225:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03290:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03368:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03493:Podnl1 APN 8 84132189 missense probably benign 0.44
PIT4472001:Podnl1 UTSW 8 84127848 missense
R1056:Podnl1 UTSW 8 84129276 missense probably benign 0.00
R1962:Podnl1 UTSW 8 84127297 missense probably benign 0.04
R4367:Podnl1 UTSW 8 84127268 missense probably benign 0.03
R4473:Podnl1 UTSW 8 84131985 missense possibly damaging 0.89
R4715:Podnl1 UTSW 8 84126061 start gained probably benign
R5009:Podnl1 UTSW 8 84126258 missense probably benign 0.01
R5013:Podnl1 UTSW 8 84126336 missense probably damaging 0.99
R5153:Podnl1 UTSW 8 84130643 missense probably benign 0.00
R7596:Podnl1 UTSW 8 84126395 missense
R8289:Podnl1 UTSW 8 84131923 missense
R8343:Podnl1 UTSW 8 84130773 missense
R8715:Podnl1 UTSW 8 84129327 missense
Predicted Primers PCR Primer
(F):5'- ATGTGAAATCTCCAGTTTAAAGGGG -3'
(R):5'- ATTACCAGGGCCTGCAAGTG -3'

Sequencing Primer
(F):5'- CTCCAGTTTAAAGGGGTTCTAAAAC -3'
(R):5'- CAAGTGGCGGGGCAATGC -3'
Posted On2015-07-07