Mutagenetix > Incidental Mutation

Incidental Mutation 'R4412:Ilf3'

327973

Institutional Source

Beutler Lab

Gene Symbol

Ilf3

Ensembl Gene

ENSMUSG00000032178

Gene Name

interleukin enhancer binding factor 3

Synonyms

NF90

MMRRC Submission

041135-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4412 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21367871-21405361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21399560 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 620 (P620S)

Ref Sequence

ENSEMBL: ENSMUSP00000150280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067646] [ENSMUST00000115414] [ENSMUST00000213518] [ENSMUST00000213603] [ENSMUST00000214758] [ENSMUST00000216892] [ENSMUST00000217348]

AlphaFold

Q9Z1X4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067646
AA Change: P607S

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000065770
Gene: ENSMUSG00000032178
AA Change: P607S

Domain	Start	End	E-Value	Type
DZF	88	342	3.87e-166	SMART
low complexity region	375	396	N/A	INTRINSIC
DSRM	402	466	2.2e-16	SMART
low complexity region	490	508	N/A	INTRINSIC
DSRM	525	589	2.73e-21	SMART
low complexity region	638	688	N/A	INTRINSIC
low complexity region	691	725	N/A	INTRINSIC
low complexity region	745	769	N/A	INTRINSIC
low complexity region	777	807	N/A	INTRINSIC
low complexity region	810	886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115414
AA Change: P607S

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000111074
Gene: ENSMUSG00000032178
AA Change: P607S

Domain	Start	End	E-Value	Type
DZF	88	342	3.87e-166	SMART
low complexity region	375	396	N/A	INTRINSIC
DSRM	402	466	2.2e-16	SMART
low complexity region	490	508	N/A	INTRINSIC
DSRM	525	589	2.73e-21	SMART
low complexity region	638	688	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213518
AA Change: P620S

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213603
AA Change: P620S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214200

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214217

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214758
AA Change: P620S

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000214821

Predicted Effect

probably benign
Transcript: ENSMUST00000215169

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215438

Predicted Effect

probably benign
Transcript: ENSMUST00000216892
AA Change: P620S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000217348
AA Change: P82S

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000217498

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene contains two double-stranded RNA binding domains and functions in the post-transcriptional regulation of gene expression. It is a component of an RNA-protein complex that may be involved in mediating the export of messenger RNAs. Alternative splicing results in multiple transcript variants encoding distinct isoforms. These isoforms are grouped into two categories, NFAR-1 or NFAR-2, based on variation at the C-terminus. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are born small and weak, show tachypnea and multi-organ apoptosis, and die neonatally due to neuromuscular respiratory failure. The diaphragm and other skeletal muscles show disorganization and paucity of myofibers,myocyte degeneration and elevated apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	C	15: 74,577,453		probably benign	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Alpl	A	G	4: 137,758,628	I2T	possibly damaging	Het
Chdh	G	T	14: 30,031,715	G194C	probably damaging	Het
Cp	A	T	3: 19,966,353	D170V	probably damaging	Het
Cpne9	A	G	6: 113,290,001	K132E	possibly damaging	Het
Cyp2b9	T	G	7: 26,198,443	L224R	probably damaging	Het
Dmxl1	A	G	18: 49,848,761	N153S	probably benign	Het
Dnah17	T	C	11: 118,073,683	Y2423C	probably damaging	Het
Dnajc14	G	T	10: 128,806,205		probably benign	Het
Eipr1	A	T	12: 28,859,373	D213V	probably damaging	Het
Fat1	T	C	8: 45,023,599	V1894A	probably damaging	Het
Flrt2	G	A	12: 95,780,273	V462I	probably benign	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Glis1	A	G	4: 107,634,718	H593R	probably damaging	Het
Gpr21	C	G	2: 37,517,432		probably benign	Het
Gsdmc3	A	G	15: 63,866,796	M139T	probably benign	Het
Hydin	C	T	8: 110,415,736	T749I	probably damaging	Het
Khdc3	A	G	9: 73,102,874	T71A	possibly damaging	Het
Ms4a12	T	C	19: 11,230,443	N33S	probably benign	Het
Nisch	A	G	14: 31,186,658		probably benign	Het
Npr2	G	A	4: 43,644,150	C593Y	probably damaging	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Olfr1231	A	G	2: 89,303,340	I84T	probably benign	Het
Palld	A	G	8: 61,687,372	Y534H	probably damaging	Het
Pcdhb10	TC	T	18: 37,414,141		probably null	Het
Plekhg3	A	C	12: 76,577,764	T1127P	probably damaging	Het
Podnl1	A	T	8: 84,130,665	H301L	probably benign	Het
Ripk2	A	G	4: 16,124,511	V399A	probably benign	Het
Rpp30	T	A	19: 36,100,255	N172K	possibly damaging	Het
Sin3b	C	T	8: 72,739,779	A291V	probably benign	Het
Slc12a6	A	T	2: 112,335,888	Q204L	possibly damaging	Het
Snx9	C	T	17: 5,908,394	T249M	probably damaging	Het
Sohlh2	C	A	3: 55,197,002	T264K	probably damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Syne2	T	A	12: 76,106,060	H6674Q	probably benign	Het
Tyw1	T	A	5: 130,335,232		probably null	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Yme1l1	G	A	2: 23,175,187	R236H	probably damaging	Het

Other mutations in Ilf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Ilf3	APN	9	21396051	missense	probably damaging	1.00
IGL01013:Ilf3	APN	9	21399691	missense	possibly damaging	0.91
IGL01352:Ilf3	APN	9	21392322	missense	possibly damaging	0.89
IGL01975:Ilf3	APN	9	21392379	missense	probably benign	0.03
IGL02826:Ilf3	APN	9	21398044	missense	probably benign	0.20
IGL03238:Ilf3	APN	9	21392350	missense	probably damaging	1.00
PIT4466001:Ilf3	UTSW	9	21403366	missense	unknown
R0047:Ilf3	UTSW	9	21388714	missense	possibly damaging	0.76
R0047:Ilf3	UTSW	9	21388714	missense	possibly damaging	0.76
R0090:Ilf3	UTSW	9	21395414	missense	probably damaging	1.00
R0355:Ilf3	UTSW	9	21397970	missense	probably damaging	1.00
R1768:Ilf3	UTSW	9	21403142	unclassified	probably benign
R1889:Ilf3	UTSW	9	21404767	unclassified	probably benign
R1895:Ilf3	UTSW	9	21404767	unclassified	probably benign
R1918:Ilf3	UTSW	9	21393714	missense	probably damaging	1.00
R2930:Ilf3	UTSW	9	21399590	missense	possibly damaging	0.91
R3912:Ilf3	UTSW	9	21398126	missense	possibly damaging	0.77
R3913:Ilf3	UTSW	9	21398126	missense	possibly damaging	0.77
R4080:Ilf3	UTSW	9	21403134	critical splice acceptor site	probably null
R4510:Ilf3	UTSW	9	21399215	missense	possibly damaging	0.95
R4511:Ilf3	UTSW	9	21399215	missense	possibly damaging	0.95
R5201:Ilf3	UTSW	9	21389383	missense	probably damaging	1.00
R5785:Ilf3	UTSW	9	21394872	missense	probably damaging	1.00
R6303:Ilf3	UTSW	9	21403136	unclassified	probably benign
R6406:Ilf3	UTSW	9	21396244	missense	probably damaging	0.99
R6434:Ilf3	UTSW	9	21403151	unclassified	probably benign
R7169:Ilf3	UTSW	9	21395426	missense	probably damaging	0.96
R7410:Ilf3	UTSW	9	21399804	missense	unknown
R7468:Ilf3	UTSW	9	21403411	missense	unknown
R7624:Ilf3	UTSW	9	21398044	missense	probably benign	0.20
R7720:Ilf3	UTSW	9	21399537	missense	possibly damaging	0.51
R8513:Ilf3	UTSW	9	21388636	missense	possibly damaging	0.92
R9056:Ilf3	UTSW	9	21403138	nonsense	probably null
R9317:Ilf3	UTSW	9	21396126	missense	probably damaging	1.00
R9522:Ilf3	UTSW	9	21394237	missense	probably benign	0.02
X0066:Ilf3	UTSW	9	21392406	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGAAAGGCTTTGGGGATAG -3'
(R):5'- GCACTTCATTATGCATGGGG -3'

Sequencing Primer
(F):5'- GGGTTAGTTCAGCCCCTACACAC -3'
(R):5'- CATTATGCATGGGGCCTCC -3'

Posted On

2015-07-07