Incidental Mutation 'R4412:Khdc3'
ID327974
Institutional Source Beutler Lab
Gene Symbol Khdc3
Ensembl Gene ENSMUSG00000092622
Gene NameKH domain containing 3, subcortical maternal complex member
Synonyms2410004A20Rik, FILIA, ecat1
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location73101836-73104438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73102874 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 71 (T71A)
Ref Sequence ENSEMBL: ENSMUSP00000133915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034737] [ENSMUST00000167514] [ENSMUST00000172578] [ENSMUST00000173734] [ENSMUST00000174203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034737
AA Change: T71A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034737
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
Pfam:MOEP19 28 113 4.5e-34 PFAM
internal_repeat_1 117 217 6.81e-11 PROSPERO
internal_repeat_1 218 316 6.81e-11 PROSPERO
internal_repeat_2 275 397 3.62e-8 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000167514
AA Change: T71A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132527
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
internal_repeat_1 117 212 2.21e-8 PROSPERO
internal_repeat_1 207 356 2.21e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172578
AA Change: T71A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133850
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
PDB:3V69|B 1 75 4e-49 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000173734
AA Change: T71A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133915
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
internal_repeat_2 116 194 1.27e-8 PROSPERO
internal_repeat_1 117 231 1.6e-13 PROSPERO
internal_repeat_1 231 341 1.6e-13 PROSPERO
internal_repeat_2 267 344 1.27e-8 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000174203
AA Change: T71A
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310
AA Change: T71A

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the KHDC1 family, members of which contain an atypical KH domain that may not bind RNA like canonical KH domains. This gene is specifically expressed in the oocytes, and recent studies suggest that it may function as a regulator of genomic imprinting in the oocyte. Mutations in this gene are associated with recurrent biparental complete hydatidiform mole. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display a maternal effect defect in embryogenesis with delayed embryonic development and spindle abnormalities resulting in decreased litter sizes for homozygous females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Khdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02987:Khdc3 APN 9 73102666 missense possibly damaging 0.56
R1487:Khdc3 UTSW 9 73102564 missense probably benign 0.19
R1523:Khdc3 UTSW 9 73103491 missense possibly damaging 0.53
R1545:Khdc3 UTSW 9 73103660 missense probably benign 0.05
R1951:Khdc3 UTSW 9 73103237 missense possibly damaging 0.48
R2935:Khdc3 UTSW 9 73103705 missense possibly damaging 0.92
R3076:Khdc3 UTSW 9 73102930 missense probably damaging 1.00
R3880:Khdc3 UTSW 9 73103590 missense possibly damaging 0.73
R3899:Khdc3 UTSW 9 73104346 intron probably benign
R3900:Khdc3 UTSW 9 73104346 intron probably benign
R4224:Khdc3 UTSW 9 73102871 missense possibly damaging 0.92
R4529:Khdc3 UTSW 9 73104019 missense possibly damaging 0.83
R4647:Khdc3 UTSW 9 73102586 missense possibly damaging 0.81
R4648:Khdc3 UTSW 9 73102586 missense possibly damaging 0.81
R5153:Khdc3 UTSW 9 73103438 missense probably benign 0.18
R5261:Khdc3 UTSW 9 73103486 missense possibly damaging 0.92
R8362:Khdc3 UTSW 9 73103566 missense possibly damaging 0.96
X0024:Khdc3 UTSW 9 73103924 missense probably benign 0.01
X0026:Khdc3 UTSW 9 73102983 missense possibly damaging 0.95
X0066:Khdc3 UTSW 9 73104181 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCGGCTACTGGAAATCATG -3'
(R):5'- ACTTGCTGGACAGGATAGCC -3'

Sequencing Primer
(F):5'- GAAAGGCCAAGGTAACCTTTTCCTG -3'
(R):5'- TGGACAGGATAGCCCTACC -3'
Posted On2015-07-07