Incidental Mutation 'R4412:Khdc3'
ID 327974
Institutional Source Beutler Lab
Gene Symbol Khdc3
Ensembl Gene ENSMUSG00000092622
Gene Name KH domain containing 3, subcortical maternal complex member
Synonyms FILIA, ecat1, 2410004A20Rik
MMRRC Submission 041135-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4412 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 73009118-73011720 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 73010156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 71 (T71A)
Ref Sequence ENSEMBL: ENSMUSP00000133915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034737] [ENSMUST00000167514] [ENSMUST00000172578] [ENSMUST00000173734] [ENSMUST00000174203]
AlphaFold Q9CWU5
Predicted Effect possibly damaging
Transcript: ENSMUST00000034737
AA Change: T71A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034737
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
Pfam:MOEP19 28 113 4.5e-34 PFAM
internal_repeat_1 117 217 6.81e-11 PROSPERO
internal_repeat_1 218 316 6.81e-11 PROSPERO
internal_repeat_2 275 397 3.62e-8 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000167514
AA Change: T71A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132527
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
internal_repeat_1 117 212 2.21e-8 PROSPERO
internal_repeat_1 207 356 2.21e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172578
AA Change: T71A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133850
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
PDB:3V69|B 1 75 4e-49 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000173734
AA Change: T71A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133915
Gene: ENSMUSG00000092622
AA Change: T71A

DomainStartEndE-ValueType
internal_repeat_2 116 194 1.27e-8 PROSPERO
internal_repeat_1 117 231 1.6e-13 PROSPERO
internal_repeat_1 231 341 1.6e-13 PROSPERO
internal_repeat_2 267 344 1.27e-8 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000174203
AA Change: T71A
SMART Domains Protein: ENSMUSP00000134473
Gene: ENSMUSG00000092310
AA Change: T71A

DomainStartEndE-ValueType
internal_repeat_1 116 173 5.47e-9 PROSPERO
internal_repeat_1 177 233 5.47e-9 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the KHDC1 family, members of which contain an atypical KH domain that may not bind RNA like canonical KH domains. This gene is specifically expressed in the oocytes, and recent studies suggest that it may function as a regulator of genomic imprinting in the oocyte. Mutations in this gene are associated with recurrent biparental complete hydatidiform mole. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display a maternal effect defect in embryogenesis with delayed embryonic development and spindle abnormalities resulting in decreased litter sizes for homozygous females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,449,302 (GRCm39) probably benign Het
Adprhl1 T C 8: 13,296,114 (GRCm39) K144E probably benign Het
Alpl A G 4: 137,485,939 (GRCm39) I2T possibly damaging Het
Chdh G T 14: 29,753,672 (GRCm39) G194C probably damaging Het
Cp A T 3: 20,020,517 (GRCm39) D170V probably damaging Het
Cpne9 A G 6: 113,266,962 (GRCm39) K132E possibly damaging Het
Cyp2b9 T G 7: 25,897,868 (GRCm39) L224R probably damaging Het
Dmxl1 A G 18: 49,981,828 (GRCm39) N153S probably benign Het
Dnah17 T C 11: 117,964,509 (GRCm39) Y2423C probably damaging Het
Dnajc14 G T 10: 128,642,074 (GRCm39) probably benign Het
Eipr1 A T 12: 28,909,372 (GRCm39) D213V probably damaging Het
Fat1 T C 8: 45,476,636 (GRCm39) V1894A probably damaging Het
Flrt2 G A 12: 95,747,047 (GRCm39) V462I probably benign Het
Gigyf2 A G 1: 87,364,582 (GRCm39) E954G probably damaging Het
Glis1 A G 4: 107,491,915 (GRCm39) H593R probably damaging Het
Gpr21 C G 2: 37,407,444 (GRCm39) probably benign Het
Gsdmc3 A G 15: 63,738,645 (GRCm39) M139T probably benign Het
Hydin C T 8: 111,142,368 (GRCm39) T749I probably damaging Het
Ilf3 C T 9: 21,310,856 (GRCm39) P620S possibly damaging Het
Ms4a12 T C 19: 11,207,807 (GRCm39) N33S probably benign Het
Nisch A G 14: 30,908,615 (GRCm39) probably benign Het
Npr2 G A 4: 43,644,150 (GRCm39) C593Y probably damaging Het
Npr3 G C 15: 11,905,235 (GRCm39) T164R probably benign Het
Or4c1 A G 2: 89,133,684 (GRCm39) I84T probably benign Het
Palld A G 8: 62,140,406 (GRCm39) Y534H probably damaging Het
Pcdhb10 TC T 18: 37,547,194 (GRCm39) probably null Het
Plekhg3 A C 12: 76,624,538 (GRCm39) T1127P probably damaging Het
Podnl1 A T 8: 84,857,294 (GRCm39) H301L probably benign Het
Ripk2 A G 4: 16,124,511 (GRCm39) V399A probably benign Het
Rpp30 T A 19: 36,077,655 (GRCm39) N172K possibly damaging Het
Sin3b C T 8: 73,466,407 (GRCm39) A291V probably benign Het
Slc12a6 A T 2: 112,166,233 (GRCm39) Q204L possibly damaging Het
Snx9 C T 17: 5,958,669 (GRCm39) T249M probably damaging Het
Sohlh2 C A 3: 55,104,423 (GRCm39) T264K probably damaging Het
Srrm2 A G 17: 24,029,442 (GRCm39) probably benign Het
Syne2 T A 12: 76,152,834 (GRCm39) H6674Q probably benign Het
Tyw1 T A 5: 130,364,073 (GRCm39) probably null Het
Vmn1r115 C T 7: 20,578,207 (GRCm39) R235K probably benign Het
Vmn2r50 A C 7: 9,784,235 (GRCm39) F80V probably damaging Het
Yme1l1 G A 2: 23,065,199 (GRCm39) R236H probably damaging Het
Other mutations in Khdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02987:Khdc3 APN 9 73,009,948 (GRCm39) missense possibly damaging 0.56
R1487:Khdc3 UTSW 9 73,009,846 (GRCm39) missense probably benign 0.19
R1523:Khdc3 UTSW 9 73,010,773 (GRCm39) missense possibly damaging 0.53
R1545:Khdc3 UTSW 9 73,010,942 (GRCm39) missense probably benign 0.05
R1951:Khdc3 UTSW 9 73,010,519 (GRCm39) missense possibly damaging 0.48
R2935:Khdc3 UTSW 9 73,010,987 (GRCm39) missense possibly damaging 0.92
R3076:Khdc3 UTSW 9 73,010,212 (GRCm39) missense probably damaging 1.00
R3880:Khdc3 UTSW 9 73,010,872 (GRCm39) missense possibly damaging 0.73
R3899:Khdc3 UTSW 9 73,011,628 (GRCm39) intron probably benign
R3900:Khdc3 UTSW 9 73,011,628 (GRCm39) intron probably benign
R4224:Khdc3 UTSW 9 73,010,153 (GRCm39) missense possibly damaging 0.92
R4529:Khdc3 UTSW 9 73,011,301 (GRCm39) missense possibly damaging 0.83
R4647:Khdc3 UTSW 9 73,009,868 (GRCm39) missense possibly damaging 0.81
R4648:Khdc3 UTSW 9 73,009,868 (GRCm39) missense possibly damaging 0.81
R5153:Khdc3 UTSW 9 73,010,720 (GRCm39) missense probably benign 0.18
R5261:Khdc3 UTSW 9 73,010,768 (GRCm39) missense possibly damaging 0.92
R8362:Khdc3 UTSW 9 73,010,848 (GRCm39) missense possibly damaging 0.96
X0024:Khdc3 UTSW 9 73,011,206 (GRCm39) missense probably benign 0.01
X0026:Khdc3 UTSW 9 73,010,265 (GRCm39) missense possibly damaging 0.95
X0066:Khdc3 UTSW 9 73,011,463 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTCGGCTACTGGAAATCATG -3'
(R):5'- ACTTGCTGGACAGGATAGCC -3'

Sequencing Primer
(F):5'- GAAAGGCCAAGGTAACCTTTTCCTG -3'
(R):5'- TGGACAGGATAGCCCTACC -3'
Posted On 2015-07-07