Incidental Mutation 'R4412:Eipr1'
ID327979
Institutional Source Beutler Lab
Gene Symbol Eipr1
Ensembl Gene ENSMUSG00000036613
Gene NameEARP complex and GARP complex interacting protein 1
SynonymsTssc1, D12Ertd604e
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location28751803-28869865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28859373 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 213 (D213V)
Ref Sequence ENSEMBL: ENSMUSP00000152220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035657] [ENSMUST00000221555] [ENSMUST00000221877]
Predicted Effect probably benign
Transcript: ENSMUST00000035657
SMART Domains Protein: ENSMUSP00000038845
Gene: ENSMUSG00000036613

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
Blast:WD40 57 100 1e-18 BLAST
WD40 122 163 6.39e0 SMART
WD40 172 213 2.29e1 SMART
WD40 216 257 6.38e-7 SMART
WD40 261 301 4.38e-5 SMART
WD40 335 375 1.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220933
Predicted Effect probably benign
Transcript: ENSMUST00000221555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221574
Predicted Effect probably damaging
Transcript: ENSMUST00000221877
AA Change: D213V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been reported in PMID 9403053 as one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. Alignment of this gene to genomic sequence data suggests that this gene resides on chromosome 2 rather than chromosome 11. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Eipr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Eipr1 APN 12 28864771 missense probably damaging 1.00
hoss UTSW 12 28864762 missense probably damaging 1.00
R0331:Eipr1 UTSW 12 28864704 nonsense probably null
R0352:Eipr1 UTSW 12 28766785 missense probably damaging 0.98
R0433:Eipr1 UTSW 12 28859331 missense possibly damaging 0.68
R1807:Eipr1 UTSW 12 28766839 missense probably damaging 1.00
R1883:Eipr1 UTSW 12 28766851 missense possibly damaging 0.82
R1926:Eipr1 UTSW 12 28864837 splice site probably null
R1981:Eipr1 UTSW 12 28863025 missense probably damaging 1.00
R2433:Eipr1 UTSW 12 28863043 missense probably damaging 1.00
R2877:Eipr1 UTSW 12 28760092 missense possibly damaging 0.70
R2970:Eipr1 UTSW 12 28847594 missense probably benign 0.00
R2990:Eipr1 UTSW 12 28859268 missense probably benign 0.06
R4463:Eipr1 UTSW 12 28859339 missense probably damaging 1.00
R5087:Eipr1 UTSW 12 28828856 missense probably benign 0.11
R5430:Eipr1 UTSW 12 28863016 missense probably damaging 1.00
R5619:Eipr1 UTSW 12 28867079 missense probably damaging 1.00
R6454:Eipr1 UTSW 12 28864762 missense probably damaging 1.00
R6696:Eipr1 UTSW 12 28859358 missense probably benign
R7038:Eipr1 UTSW 12 28751818 unclassified probably benign
R7417:Eipr1 UTSW 12 28866955 missense probably benign 0.04
R7808:Eipr1 UTSW 12 28766770 critical splice acceptor site probably null
R8037:Eipr1 UTSW 12 28864677 missense probably benign 0.00
Z1176:Eipr1 UTSW 12 28859287 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGACCGAACCTCCAAATTGTTC -3'
(R):5'- AAGCCCTGGACTTGGTTTCC -3'

Sequencing Primer
(F):5'- TCCTGAGAATTGTGTAAAGAGTCCAG -3'
(R):5'- TACGCTGCCTCTGACACAG -3'
Posted On2015-07-07