Mutagenetix > Incidental Mutation

Incidental Mutation 'R4412:Flrt2'

327982

Institutional Source

Beutler Lab

Gene Symbol

Flrt2

Ensembl Gene

ENSMUSG00000047414

Gene Name

fibronectin leucine rich transmembrane protein 2

Synonyms

MMRRC Submission

041135-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4412 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95692226-95785215 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 95780273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 462 (V462I)

Ref Sequence

ENSEMBL: ENSMUSP00000105744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057324] [ENSMUST00000110117]

AlphaFold

Q8BLU0

PDB Structure

mouse FLRT2 LRR domain in complex with rat Unc5D Ig1 domain [X-RAY DIFFRACTION]
FLRT2 LRR domain [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000057324
AA Change: V462I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000062171
Gene: ENSMUSG00000047414
AA Change: V462I

Domain	Start	End	E-Value	Type
LRRNT	35	67	1.51e-4	SMART
LRR	107	131	1.29e1	SMART
LRR	132	157	4.32e0	SMART
LRR	159	181	6.78e1	SMART
LRR	182	202	6.97e1	SMART
LRR	203	228	7.16e0	SMART
LRR	252	274	5.26e0	SMART
LRR_TYP	275	298	2.43e-4	SMART
LRRCT	310	361	1.17e-7	SMART
low complexity region	368	400	N/A	INTRINSIC
FN3	420	502	5.07e0	SMART
transmembrane domain	542	564	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110117
AA Change: V462I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105744
Gene: ENSMUSG00000047414
AA Change: V462I

Domain	Start	End	E-Value	Type
LRRNT	35	67	1.51e-4	SMART
LRR	107	131	1.29e1	SMART
LRR	132	157	4.32e0	SMART
LRR	159	181	6.78e1	SMART
LRR	182	202	6.97e1	SMART
LRR	203	228	7.16e0	SMART
LRR	252	274	5.26e0	SMART
LRR_TYP	275	298	2.43e-4	SMART
LRRCT	310	361	1.17e-7	SMART
low complexity region	368	400	N/A	INTRINSIC
FN3	420	502	5.07e0	SMART
transmembrane domain	542	564	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibronectin leucine rich transmembrane (FLRT) family of cell adhesion molecules, which regulate early embryonic vascular and neural development. The encoded type I transmembrane protein has an extracellular region consisting of an N-terminal leucine-rich repeat domain and a type 3 fibronectin domain, followed by a transmembrane domain and a short C-terminal cytoplasmic tail domain. It functions as both a homophilic cell adhesion molecule and a heterophilic chemorepellent through its interaction with members of the uncoordinated-5 receptor family. Proteolytic removal of the extracellular region controls the migration of neurons in the developing cortex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic, fetal, and postnatel lethality with few mice surviving to weaning due to defects in epicardium, myocardium, and endocardium development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	T	C	15: 74,577,453		probably benign	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Alpl	A	G	4: 137,758,628	I2T	possibly damaging	Het
Chdh	G	T	14: 30,031,715	G194C	probably damaging	Het
Cp	A	T	3: 19,966,353	D170V	probably damaging	Het
Cpne9	A	G	6: 113,290,001	K132E	possibly damaging	Het
Cyp2b9	T	G	7: 26,198,443	L224R	probably damaging	Het
Dmxl1	A	G	18: 49,848,761	N153S	probably benign	Het
Dnah17	T	C	11: 118,073,683	Y2423C	probably damaging	Het
Dnajc14	G	T	10: 128,806,205		probably benign	Het
Eipr1	A	T	12: 28,859,373	D213V	probably damaging	Het
Fat1	T	C	8: 45,023,599	V1894A	probably damaging	Het
Gigyf2	A	G	1: 87,436,860	E954G	probably damaging	Het
Glis1	A	G	4: 107,634,718	H593R	probably damaging	Het
Gpr21	C	G	2: 37,517,432		probably benign	Het
Gsdmc3	A	G	15: 63,866,796	M139T	probably benign	Het
Hydin	C	T	8: 110,415,736	T749I	probably damaging	Het
Ilf3	C	T	9: 21,399,560	P620S	possibly damaging	Het
Khdc3	A	G	9: 73,102,874	T71A	possibly damaging	Het
Ms4a12	T	C	19: 11,230,443	N33S	probably benign	Het
Nisch	A	G	14: 31,186,658		probably benign	Het
Npr2	G	A	4: 43,644,150	C593Y	probably damaging	Het
Npr3	G	C	15: 11,905,149	T164R	probably benign	Het
Olfr1231	A	G	2: 89,303,340	I84T	probably benign	Het
Palld	A	G	8: 61,687,372	Y534H	probably damaging	Het
Pcdhb10	TC	T	18: 37,414,141		probably null	Het
Plekhg3	A	C	12: 76,577,764	T1127P	probably damaging	Het
Podnl1	A	T	8: 84,130,665	H301L	probably benign	Het
Ripk2	A	G	4: 16,124,511	V399A	probably benign	Het
Rpp30	T	A	19: 36,100,255	N172K	possibly damaging	Het
Sin3b	C	T	8: 72,739,779	A291V	probably benign	Het
Slc12a6	A	T	2: 112,335,888	Q204L	possibly damaging	Het
Snx9	C	T	17: 5,908,394	T249M	probably damaging	Het
Sohlh2	C	A	3: 55,197,002	T264K	probably damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Syne2	T	A	12: 76,106,060	H6674Q	probably benign	Het
Tyw1	T	A	5: 130,335,232		probably null	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Yme1l1	G	A	2: 23,175,187	R236H	probably damaging	Het

Other mutations in Flrt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Flrt2	APN	12	95780529	missense	probably damaging	1.00
IGL01083:Flrt2	APN	12	95780347	missense	probably benign	0.05
IGL01410:Flrt2	APN	12	95779192	missense	probably damaging	1.00
IGL01601:Flrt2	APN	12	95779595	missense	probably damaging	0.99
IGL01800:Flrt2	APN	12	95779688	missense	probably damaging	1.00
IGL01940:Flrt2	APN	12	95780238	missense	probably damaging	1.00
IGL02224:Flrt2	APN	12	95780028	missense	possibly damaging	0.58
IGL02272:Flrt2	APN	12	95779704	missense	probably damaging	1.00
IGL02452:Flrt2	APN	12	95779483	missense	probably benign	0.01
R0966:Flrt2	UTSW	12	95780301	missense	possibly damaging	0.70
R1066:Flrt2	UTSW	12	95779059	missense	probably damaging	1.00
R1218:Flrt2	UTSW	12	95778953	missense	probably benign	0.00
R1442:Flrt2	UTSW	12	95780205	missense	probably damaging	1.00
R1462:Flrt2	UTSW	12	95779338	missense	probably damaging	1.00
R1462:Flrt2	UTSW	12	95779338	missense	probably damaging	1.00
R1746:Flrt2	UTSW	12	95780792	missense	possibly damaging	0.90
R1842:Flrt2	UTSW	12	95779284	missense	probably damaging	1.00
R1901:Flrt2	UTSW	12	95779130	missense	probably damaging	1.00
R1901:Flrt2	UTSW	12	95779131	missense	probably damaging	1.00
R1959:Flrt2	UTSW	12	95780300	missense	probably benign	0.01
R2310:Flrt2	UTSW	12	95780090	missense	probably benign	0.01
R3418:Flrt2	UTSW	12	95780604	missense	probably damaging	1.00
R3419:Flrt2	UTSW	12	95780604	missense	probably damaging	1.00
R4617:Flrt2	UTSW	12	95780229	missense	possibly damaging	0.96
R4674:Flrt2	UTSW	12	95780688	nonsense	probably null
R5001:Flrt2	UTSW	12	95778951	missense	probably benign
R5009:Flrt2	UTSW	12	95779773	missense	probably damaging	0.98
R5150:Flrt2	UTSW	12	95779203	missense	possibly damaging	0.84
R5179:Flrt2	UTSW	12	95780347	missense	probably benign	0.05
R5269:Flrt2	UTSW	12	95779938	missense	possibly damaging	0.46
R5535:Flrt2	UTSW	12	95780426	missense	probably benign	0.08
R6172:Flrt2	UTSW	12	95779531	missense	probably damaging	1.00
R6180:Flrt2	UTSW	12	95779238	nonsense	probably null
R6867:Flrt2	UTSW	12	95779382	missense	probably damaging	1.00
R6986:Flrt2	UTSW	12	95780685	missense	probably damaging	1.00
R7379:Flrt2	UTSW	12	95780555	missense	possibly damaging	0.68
R7407:Flrt2	UTSW	12	95779300	missense	probably damaging	1.00
R7711:Flrt2	UTSW	12	95780754	missense	probably damaging	1.00
R8065:Flrt2	UTSW	12	95780774	missense	probably benign	0.00
R8109:Flrt2	UTSW	12	95780559	missense	probably benign	0.00
R8306:Flrt2	UTSW	12	95779302	missense	probably damaging	1.00
R8416:Flrt2	UTSW	12	95779557	missense	probably benign	0.10
R9065:Flrt2	UTSW	12	95779403	missense	probably damaging	1.00
R9090:Flrt2	UTSW	12	95779133	missense	probably benign	0.15
R9271:Flrt2	UTSW	12	95779133	missense	probably benign	0.15
R9681:Flrt2	UTSW	12	95778651	start gained	probably benign
Z1176:Flrt2	UTSW	12	95778912	missense	possibly damaging	0.76
Z1176:Flrt2	UTSW	12	95779559	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGCTCCAAGTACCGTTTC -3'
(R):5'- TGCCGTTGTTCAAATAAGAGGC -3'

Sequencing Primer
(F):5'- TGTTCCAAGCCCCAGCAGAG -3'
(R):5'- CCGTTGTTCAAATAAGAGGCATGGG -3'

Posted On

2015-07-07