Incidental Mutation 'R4412:Nisch'
ID327984
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4412 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 31186658 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000164989] [ENSMUST00000165981] [ENSMUST00000168206] [ENSMUST00000172142]
Predicted Effect probably benign
Transcript: ENSMUST00000022469
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164956
Predicted Effect probably benign
Transcript: ENSMUST00000164989
SMART Domains Protein: ENSMUSP00000126982
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_4 289 332 3.2e-8 PFAM
Pfam:LRR_1 290 311 2.9e-3 PFAM
Pfam:LRR_1 313 332 4.2e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165981
AA Change: V470A
SMART Domains Protein: ENSMUSP00000130210
Gene: ENSMUSG00000021910
AA Change: V470A

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_7 289 305 7.4e-2 PFAM
Pfam:LRR_6 289 309 3.8e-2 PFAM
Pfam:LRR_4 289 333 5.9e-8 PFAM
Pfam:LRR_8 289 346 6.8e-10 PFAM
Pfam:LRR_1 290 311 4.4e-3 PFAM
Pfam:LRR_8 312 369 7.3e-9 PFAM
Pfam:LRR_1 313 333 1.8e-2 PFAM
Pfam:LRR_4 329 377 2.3e-8 PFAM
Pfam:LRR_6 333 354 2e-3 PFAM
Pfam:LRR_7 334 350 1.9e-1 PFAM
Pfam:LRR_1 335 354 1.2e-2 PFAM
Blast:LRR 378 403 1e-6 BLAST
Blast:LRR 403 429 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167979
Predicted Effect probably benign
Transcript: ENSMUST00000168206
SMART Domains Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Pfam:LRR_8 44 101 3.9e-9 PFAM
Pfam:LRR_1 45 66 2.6e-2 PFAM
Pfam:LRR_6 88 109 1.1e-2 PFAM
Pfam:LRR_4 89 132 6.5e-8 PFAM
Pfam:LRR_1 90 109 6.9e-2 PFAM
Blast:LRR 133 158 4e-7 BLAST
Blast:LRR 158 184 6e-7 BLAST
low complexity region 244 256 N/A INTRINSIC
low complexity region 272 289 N/A INTRINSIC
coiled coil region 380 405 N/A INTRINSIC
low complexity region 417 450 N/A INTRINSIC
low complexity region 793 824 N/A INTRINSIC
low complexity region 836 948 N/A INTRINSIC
low complexity region 1246 1264 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168451
SMART Domains Protein: ENSMUSP00000132912
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Pfam:PX 4 53 5.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169149
SMART Domains Protein: ENSMUSP00000131623
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Blast:PX 2 27 1e-10 BLAST
PDB:3P0C|B 2 33 7e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170253
SMART Domains Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
SCOP:d1dcea3 2 86 3e-11 SMART
Blast:LRR 13 34 1e-5 BLAST
Blast:LRR 35 60 1e-7 BLAST
Blast:LRR 60 86 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170343
SMART Domains Protein: ENSMUSP00000130246
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Pfam:LRR_8 74 131 2.3e-8 PFAM
Blast:LRR 140 165 7e-7 BLAST
Blast:LRR 165 191 6e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172370
Predicted Effect probably benign
Transcript: ENSMUST00000172142
SMART Domains Protein: ENSMUSP00000132413
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
Pfam:LRR_7 289 305 8.2e-2 PFAM
Pfam:LRR_6 289 309 4.2e-2 PFAM
Pfam:LRR_4 289 333 6.6e-8 PFAM
Pfam:LRR_8 289 346 7.6e-10 PFAM
Pfam:LRR_1 290 311 4.9e-3 PFAM
Pfam:LRR_8 312 369 7.7e-9 PFAM
Pfam:LRR_1 313 333 2e-2 PFAM
Pfam:LRR_4 329 377 2.7e-8 PFAM
Pfam:LRR_6 333 354 2.2e-3 PFAM
Pfam:LRR_7 334 350 2.1e-1 PFAM
Pfam:LRR_1 335 354 1.3e-2 PFAM
Blast:LRR 378 403 1e-6 BLAST
Blast:LRR 403 429 1e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170436
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Pcdhb10 TC T 18: 37,414,141 probably null Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0196:Nisch UTSW 14 31203394 unclassified probably benign
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0452:Nisch UTSW 14 31177464 utr 3 prime probably benign
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 splice site probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6327:Nisch UTSW 14 31171487 utr 3 prime probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R6887:Nisch UTSW 14 31185344 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7870:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7887:Nisch UTSW 14 31176695 nonsense probably null
R8215:Nisch UTSW 14 31186701 missense possibly damaging 0.59
R8672:Nisch UTSW 14 31173136 missense probably damaging 1.00
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAAACAATCTTTCTGTGCCC -3'
(R):5'- TTGGATGAGGTCAAGAGCATTG -3'

Sequencing Primer
(F):5'- GAAACAATCTTTCTGTGCCCATGTG -3'
(R):5'- AGCGTTTGACCTTGCTGAACAAC -3'
Posted On2015-07-07