Incidental Mutation 'R4412:Pcdhb10'
ID327990
Institutional Source Beutler Lab
Gene Symbol Pcdhb10
Ensembl Gene ENSMUSG00000045657
Gene Nameprotocadherin beta 10
SynonymsPcdhb5D, PcdhbJ
MMRRC Submission 041135-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4412 (G1)
Quality Score217
Status Not validated
Chromosome18
Chromosomal Location37411664-37414514 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TC to T at 37414141 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000056420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051126] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably null
Transcript: ENSMUST00000051126
SMART Domains Protein: ENSMUSP00000056420
Gene: ENSMUSG00000045657

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 5.5e-33 PFAM
CA 155 240 5.59e-23 SMART
CA 264 344 5.17e-27 SMART
CA 367 448 5.59e-23 SMART
CA 472 558 6.62e-25 SMART
CA 588 669 2.03e-11 SMART
Pfam:Cadherin_C_2 686 769 1.5e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,577,453 probably benign Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Alpl A G 4: 137,758,628 I2T possibly damaging Het
Chdh G T 14: 30,031,715 G194C probably damaging Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Cpne9 A G 6: 113,290,001 K132E possibly damaging Het
Cyp2b9 T G 7: 26,198,443 L224R probably damaging Het
Dmxl1 A G 18: 49,848,761 N153S probably benign Het
Dnah17 T C 11: 118,073,683 Y2423C probably damaging Het
Dnajc14 G T 10: 128,806,205 probably benign Het
Eipr1 A T 12: 28,859,373 D213V probably damaging Het
Fat1 T C 8: 45,023,599 V1894A probably damaging Het
Flrt2 G A 12: 95,780,273 V462I probably benign Het
Gigyf2 A G 1: 87,436,860 E954G probably damaging Het
Glis1 A G 4: 107,634,718 H593R probably damaging Het
Gpr21 C G 2: 37,517,432 probably benign Het
Gsdmc3 A G 15: 63,866,796 M139T probably benign Het
Hydin C T 8: 110,415,736 T749I probably damaging Het
Ilf3 C T 9: 21,399,560 P620S possibly damaging Het
Khdc3 A G 9: 73,102,874 T71A possibly damaging Het
Ms4a12 T C 19: 11,230,443 N33S probably benign Het
Nisch A G 14: 31,186,658 probably benign Het
Npr2 G A 4: 43,644,150 C593Y probably damaging Het
Npr3 G C 15: 11,905,149 T164R probably benign Het
Olfr1231 A G 2: 89,303,340 I84T probably benign Het
Palld A G 8: 61,687,372 Y534H probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Podnl1 A T 8: 84,130,665 H301L probably benign Het
Ripk2 A G 4: 16,124,511 V399A probably benign Het
Rpp30 T A 19: 36,100,255 N172K possibly damaging Het
Sin3b C T 8: 72,739,779 A291V probably benign Het
Slc12a6 A T 2: 112,335,888 Q204L possibly damaging Het
Snx9 C T 17: 5,908,394 T249M probably damaging Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syne2 T A 12: 76,106,060 H6674Q probably benign Het
Tyw1 T A 5: 130,335,232 probably null Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Yme1l1 G A 2: 23,175,187 R236H probably damaging Het
Other mutations in Pcdhb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Pcdhb10 APN 18 37412195 missense probably damaging 0.96
IGL01383:Pcdhb10 APN 18 37413275 missense probably benign 0.14
IGL01765:Pcdhb10 APN 18 37414019 missense probably benign 0.00
IGL02240:Pcdhb10 APN 18 37412402 missense possibly damaging 0.90
IGL02548:Pcdhb10 APN 18 37412690 missense probably benign 0.00
IGL02563:Pcdhb10 APN 18 37413073 missense probably benign 0.26
IGL02598:Pcdhb10 APN 18 37413781 missense possibly damaging 0.89
IGL02711:Pcdhb10 APN 18 37412726 missense possibly damaging 0.56
IGL02813:Pcdhb10 APN 18 37413762 missense possibly damaging 0.94
IGL02893:Pcdhb10 APN 18 37413634 missense probably damaging 1.00
IGL03288:Pcdhb10 APN 18 37413305 missense probably damaging 1.00
IGL03310:Pcdhb10 APN 18 37412321 missense probably damaging 0.97
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0004:Pcdhb10 UTSW 18 37411959 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0211:Pcdhb10 UTSW 18 37414006 missense probably benign
R0389:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0443:Pcdhb10 UTSW 18 37412432 missense probably damaging 1.00
R0480:Pcdhb10 UTSW 18 37413099 missense probably damaging 1.00
R1218:Pcdhb10 UTSW 18 37413161 missense probably damaging 1.00
R1448:Pcdhb10 UTSW 18 37412503 missense possibly damaging 0.89
R1737:Pcdhb10 UTSW 18 37412956 missense probably benign 0.01
R2092:Pcdhb10 UTSW 18 37414187 missense probably benign 0.00
R2277:Pcdhb10 UTSW 18 37412624 missense possibly damaging 0.82
R2363:Pcdhb10 UTSW 18 37414137 nonsense probably null
R3826:Pcdhb10 UTSW 18 37412417 missense probably damaging 1.00
R4372:Pcdhb10 UTSW 18 37413313 missense possibly damaging 0.95
R4760:Pcdhb10 UTSW 18 37411942 missense probably benign 0.05
R4941:Pcdhb10 UTSW 18 37412834 missense probably benign 0.29
R5271:Pcdhb10 UTSW 18 37413169 missense probably benign 0.44
R5643:Pcdhb10 UTSW 18 37413166 missense possibly damaging 0.63
R5851:Pcdhb10 UTSW 18 37412758 missense probably benign 0.00
R6089:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6125:Pcdhb10 UTSW 18 37413626 missense possibly damaging 0.91
R6189:Pcdhb10 UTSW 18 37412403 missense probably damaging 0.99
R6414:Pcdhb10 UTSW 18 37413845 missense possibly damaging 0.95
R6731:Pcdhb10 UTSW 18 37413476 missense probably benign 0.02
R6999:Pcdhb10 UTSW 18 37413118 missense probably damaging 1.00
R7019:Pcdhb10 UTSW 18 37413003 missense probably damaging 1.00
R7317:Pcdhb10 UTSW 18 37413026 missense possibly damaging 0.67
R7554:Pcdhb10 UTSW 18 37411882 missense probably benign
R7638:Pcdhb10 UTSW 18 37412312 missense probably benign 0.03
R7710:Pcdhb10 UTSW 18 37413601 nonsense probably null
R7763:Pcdhb10 UTSW 18 37411882 missense not run
R7867:Pcdhb10 UTSW 18 37413566 missense probably benign 0.03
R8269:Pcdhb10 UTSW 18 37414009 missense probably benign 0.09
R8355:Pcdhb10 UTSW 18 37412081 missense probably damaging 1.00
X0024:Pcdhb10 UTSW 18 37412998 missense probably benign 0.12
X0036:Pcdhb10 UTSW 18 37411973 missense probably damaging 1.00
Z1176:Pcdhb10 UTSW 18 37413395 frame shift probably null
Z1177:Pcdhb10 UTSW 18 37412543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGCTGTACTTGGTCATTG -3'
(R):5'- ATGCATACACTTTGACTACAGTGC -3'

Sequencing Primer
(F):5'- ACGCTGTACTTGGTCATTGCTTTG -3'
(R):5'- TCACTTTCTTAAGAGAACCATATTGC -3'
Posted On2015-07-07