Mutagenetix > Incidental Mutation

Incidental Mutation 'R4413:Exoc1'

328012

Institutional Source

Beutler Lab

Gene Symbol

Exoc1

Ensembl Gene

ENSMUSG00000036435

Gene Name

exocyst complex component 1

Synonyms

2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1

MMRRC Submission

041136-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4413 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76529311-76570294 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 76542019 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109121 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493]

AlphaFold

Q8R3S6

Predicted Effect

probably benign
Transcript: ENSMUST00000049469

SMART Domains

Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	856	5.5e-221	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000087133

SMART Domains

Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
Pfam:Sec3_C	169	871	2e-220	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113493

SMART Domains

Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435

Domain	Start	End	E-Value	Type
Sec3-PIP2_bind	31	122	9.51e-41	SMART
coiled coil region	161	183	N/A	INTRINSIC
Pfam:Sec3_C	190	878	4.1e-186	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131470

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137018

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150829

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

93% (42/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,958,681		probably null	Het
Adprhl1	T	C	8: 13,246,114	K144E	probably benign	Het
Bcdin3d	A	G	15: 99,470,733	L195P	probably damaging	Het
Col11a1	T	A	3: 114,108,316	S553R	unknown	Het
Cp	A	T	3: 19,966,353	D170V	probably damaging	Het
Dnah17	C	T	11: 118,025,168	A4303T	probably benign	Het
Dpp4	G	A	2: 62,387,140	R38C	possibly damaging	Het
Dusp6	C	T	10: 99,263,924	T78M	probably damaging	Het
Fbxl13	A	T	5: 21,582,053	C295*	probably null	Het
Gpsm1	G	A	2: 26,319,831		probably benign	Het
Gstm4	T	A	3: 108,043,328	D85V	possibly damaging	Het
Hectd4	A	G	5: 121,350,481	N3612D	possibly damaging	Het
Izumo3	T	C	4: 92,146,899	D27G	probably damaging	Het
Kcna4	T	A	2: 107,295,373	C151S	probably benign	Het
Lrrc10	A	G	10: 117,045,814	N131S	probably damaging	Het
Madd	A	G	2: 91,167,587	S699P	probably damaging	Het
Mcpt4	A	T	14: 56,060,536	V186D	probably damaging	Het
Mrgprx3-ps	T	C	7: 47,309,998		noncoding transcript	Het
Mrm1	G	T	11: 84,819,228	R49S	possibly damaging	Het
Nav2	T	A	7: 49,398,109	N91K	probably benign	Het
Noct	C	T	3: 51,250,335	R365W	probably damaging	Het
Ntn1	C	T	11: 68,385,910	G71S	probably damaging	Het
Olfr417	T	C	1: 174,369,474	S186P	probably damaging	Het
Plekhg3	A	C	12: 76,577,764	T1127P	probably damaging	Het
Rhbdl2	A	T	4: 123,810,087	M52L	probably benign	Het
Slc10a1	T	C	12: 80,958,132	N212S	probably benign	Het
Sohlh2	C	A	3: 55,197,002	T264K	probably damaging	Het
Srrm2	A	G	17: 23,810,468		probably benign	Het
Syn3	C	A	10: 86,055,592		probably benign	Het
Taf5	T	A	19: 47,071,014	V199D	probably damaging	Het
Tas2r136	C	A	6: 132,778,009	V52L	probably damaging	Het
Tex45	T	A	8: 3,483,529	H278Q	probably damaging	Het
Tnk2	C	T	16: 32,669,501	R191C	probably damaging	Het
Ttn	A	G	2: 76,725,776	I21968T	probably damaging	Het
Ubxn6	A	T	17: 56,069,303	V311E	probably damaging	Het
Usp7	C	A	16: 8,708,914	D187Y	probably damaging	Het
Vmn1r115	C	T	7: 20,844,282	R235K	probably benign	Het
Vmn2r50	A	C	7: 10,050,308	F80V	probably damaging	Het
Vmn2r58	T	A	7: 41,861,936	K481M	possibly damaging	Het
Vmn2r86	A	G	10: 130,452,600	I344T	possibly damaging	Het
Vmn2r99	T	A	17: 19,379,260	V402E	probably damaging	Het
Zfp462	A	G	4: 55,012,672	D1546G	probably damaging	Het

Other mutations in Exoc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00679:Exoc1	APN	5	76567023	missense	possibly damaging	0.88
IGL01149:Exoc1	APN	5	76542244	splice site	probably benign
IGL02061:Exoc1	APN	5	76542120	missense	probably damaging	0.96
IGL02288:Exoc1	APN	5	76545313	missense	probably benign
IGL02407:Exoc1	APN	5	76545346	missense	probably damaging	0.97
IGL03089:Exoc1	APN	5	76542158	missense	possibly damaging	0.81
IGL03242:Exoc1	APN	5	76559007	missense	probably damaging	1.00
IGL03348:Exoc1	APN	5	76535593	missense	probably damaging	1.00
IGL03411:Exoc1	APN	5	76542195	missense	probably damaging	1.00
Smalls	UTSW	5	76537779	missense	probably damaging	1.00
R0462:Exoc1	UTSW	5	76543617	missense	probably benign	0.37
R1216:Exoc1	UTSW	5	76554188	missense	probably benign
R1528:Exoc1	UTSW	5	76549564	missense	possibly damaging	0.94
R1531:Exoc1	UTSW	5	76559164	missense	probably damaging	0.98
R1636:Exoc1	UTSW	5	76568118	missense	probably benign	0.03
R1754:Exoc1	UTSW	5	76560322	splice site	probably null
R1803:Exoc1	UTSW	5	76561441	missense	probably benign	0.18
R2086:Exoc1	UTSW	5	76532846	nonsense	probably null
R2239:Exoc1	UTSW	5	76559710	unclassified	probably benign
R3914:Exoc1	UTSW	5	76543561	missense	possibly damaging	0.54
R4022:Exoc1	UTSW	5	76549570	missense	possibly damaging	0.92
R4329:Exoc1	UTSW	5	76567975	missense	probably damaging	1.00
R4427:Exoc1	UTSW	5	76563263	missense	probably benign	0.00
R4557:Exoc1	UTSW	5	76561443	missense	probably damaging	1.00
R4627:Exoc1	UTSW	5	76542228	missense	probably benign	0.26
R4677:Exoc1	UTSW	5	76559163	missense	probably null	0.82
R5138:Exoc1	UTSW	5	76568075	missense	probably damaging	1.00
R5325:Exoc1	UTSW	5	76537702	missense	probably benign
R5342:Exoc1	UTSW	5	76567014	missense	probably damaging	1.00
R5736:Exoc1	UTSW	5	76537768	missense	possibly damaging	0.90
R5891:Exoc1	UTSW	5	76542144	missense	probably damaging	1.00
R6102:Exoc1	UTSW	5	76537779	missense	probably damaging	1.00
R6447:Exoc1	UTSW	5	76543517	missense	probably damaging	0.97
R6532:Exoc1	UTSW	5	76537837	missense	probably damaging	0.99
R6694:Exoc1	UTSW	5	76549552	missense	probably damaging	1.00
R6753:Exoc1	UTSW	5	76563339	missense	probably damaging	1.00
R6885:Exoc1	UTSW	5	76559042	missense	probably damaging	1.00
R7090:Exoc1	UTSW	5	76566953	missense	unknown
R7299:Exoc1	UTSW	5	76542159	missense	probably damaging	1.00
R7439:Exoc1	UTSW	5	76545348	missense	probably benign	0.18
R7567:Exoc1	UTSW	5	76537715	missense	probably damaging	0.96
R7665:Exoc1	UTSW	5	76543573	missense	probably benign	0.33
R7745:Exoc1	UTSW	5	76561512	nonsense	probably null
R7883:Exoc1	UTSW	5	76561382	missense	probably damaging	0.99
R7918:Exoc1	UTSW	5	76543993	missense	probably benign	0.10
R7956:Exoc1	UTSW	5	76557857	missense	probably benign	0.01
R7977:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R7987:Exoc1	UTSW	5	76543585	missense	probably damaging	1.00
R8191:Exoc1	UTSW	5	76559827	critical splice donor site	probably null
R8286:Exoc1	UTSW	5	76563240	missense	probably benign	0.00
R8670:Exoc1	UTSW	5	76569658	missense	probably damaging	1.00
R8791:Exoc1	UTSW	5	76535565	missense	probably damaging	1.00
R9308:Exoc1	UTSW	5	76559121	missense	probably benign	0.10
R9410:Exoc1	UTSW	5	76559142	missense	probably benign	0.21
X0018:Exoc1	UTSW	5	76567035	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACACTTGTAAGTCAGCAAGCATAC -3'
(R):5'- CTTCAGCGTTAGAAATGGCG -3'

Sequencing Primer
(F):5'- AGCATACTAGACTGCATGCTTTCTG -3'
(R):5'- CGTTAGAAATGGCGCACTC -3'

Posted On

2015-07-07