Incidental Mutation 'R4413:Exoc1'
ID 328012
Institutional Source Beutler Lab
Gene Symbol Exoc1
Ensembl Gene ENSMUSG00000036435
Gene Name exocyst complex component 1
Synonyms 2810407P21Rik, Sec3p, SEC3, A730011E05Rik, Sec3l1
MMRRC Submission 041136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4413 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 76529311-76570294 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 76542019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049469] [ENSMUST00000087133] [ENSMUST00000113493]
AlphaFold Q8R3S6
Predicted Effect probably benign
Transcript: ENSMUST00000049469
SMART Domains Protein: ENSMUSP00000046719
Gene: ENSMUSG00000036435

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 856 5.5e-221 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087133
SMART Domains Protein: ENSMUSP00000084373
Gene: ENSMUSG00000036435

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
Pfam:Sec3_C 169 871 2e-220 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113493
SMART Domains Protein: ENSMUSP00000109121
Gene: ENSMUSG00000036435

DomainStartEndE-ValueType
Sec3-PIP2_bind 31 122 9.51e-41 SMART
coiled coil region 161 183 N/A INTRINSIC
Pfam:Sec3_C 190 878 4.1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150829
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Mrm1 G T 11: 84,819,228 R49S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syn3 C A 10: 86,055,592 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 V402E probably damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Exoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Exoc1 APN 5 76567023 missense possibly damaging 0.88
IGL01149:Exoc1 APN 5 76542244 splice site probably benign
IGL02061:Exoc1 APN 5 76542120 missense probably damaging 0.96
IGL02288:Exoc1 APN 5 76545313 missense probably benign
IGL02407:Exoc1 APN 5 76545346 missense probably damaging 0.97
IGL03089:Exoc1 APN 5 76542158 missense possibly damaging 0.81
IGL03242:Exoc1 APN 5 76559007 missense probably damaging 1.00
IGL03348:Exoc1 APN 5 76535593 missense probably damaging 1.00
IGL03411:Exoc1 APN 5 76542195 missense probably damaging 1.00
Smalls UTSW 5 76537779 missense probably damaging 1.00
R0462:Exoc1 UTSW 5 76543617 missense probably benign 0.37
R1216:Exoc1 UTSW 5 76554188 missense probably benign
R1528:Exoc1 UTSW 5 76549564 missense possibly damaging 0.94
R1531:Exoc1 UTSW 5 76559164 missense probably damaging 0.98
R1636:Exoc1 UTSW 5 76568118 missense probably benign 0.03
R1754:Exoc1 UTSW 5 76560322 splice site probably null
R1803:Exoc1 UTSW 5 76561441 missense probably benign 0.18
R2086:Exoc1 UTSW 5 76532846 nonsense probably null
R2239:Exoc1 UTSW 5 76559710 unclassified probably benign
R3914:Exoc1 UTSW 5 76543561 missense possibly damaging 0.54
R4022:Exoc1 UTSW 5 76549570 missense possibly damaging 0.92
R4329:Exoc1 UTSW 5 76567975 missense probably damaging 1.00
R4427:Exoc1 UTSW 5 76563263 missense probably benign 0.00
R4557:Exoc1 UTSW 5 76561443 missense probably damaging 1.00
R4627:Exoc1 UTSW 5 76542228 missense probably benign 0.26
R4677:Exoc1 UTSW 5 76559163 missense probably null 0.82
R5138:Exoc1 UTSW 5 76568075 missense probably damaging 1.00
R5325:Exoc1 UTSW 5 76537702 missense probably benign
R5342:Exoc1 UTSW 5 76567014 missense probably damaging 1.00
R5736:Exoc1 UTSW 5 76537768 missense possibly damaging 0.90
R5891:Exoc1 UTSW 5 76542144 missense probably damaging 1.00
R6102:Exoc1 UTSW 5 76537779 missense probably damaging 1.00
R6447:Exoc1 UTSW 5 76543517 missense probably damaging 0.97
R6532:Exoc1 UTSW 5 76537837 missense probably damaging 0.99
R6694:Exoc1 UTSW 5 76549552 missense probably damaging 1.00
R6753:Exoc1 UTSW 5 76563339 missense probably damaging 1.00
R6885:Exoc1 UTSW 5 76559042 missense probably damaging 1.00
R7090:Exoc1 UTSW 5 76566953 missense unknown
R7299:Exoc1 UTSW 5 76542159 missense probably damaging 1.00
R7439:Exoc1 UTSW 5 76545348 missense probably benign 0.18
R7567:Exoc1 UTSW 5 76537715 missense probably damaging 0.96
R7665:Exoc1 UTSW 5 76543573 missense probably benign 0.33
R7745:Exoc1 UTSW 5 76561512 nonsense probably null
R7883:Exoc1 UTSW 5 76561382 missense probably damaging 0.99
R7918:Exoc1 UTSW 5 76543993 missense probably benign 0.10
R7956:Exoc1 UTSW 5 76557857 missense probably benign 0.01
R7977:Exoc1 UTSW 5 76543585 missense probably damaging 1.00
R7987:Exoc1 UTSW 5 76543585 missense probably damaging 1.00
R8191:Exoc1 UTSW 5 76559827 critical splice donor site probably null
R8286:Exoc1 UTSW 5 76563240 missense probably benign 0.00
R8670:Exoc1 UTSW 5 76569658 missense probably damaging 1.00
R8791:Exoc1 UTSW 5 76535565 missense probably damaging 1.00
R9308:Exoc1 UTSW 5 76559121 missense probably benign 0.10
R9410:Exoc1 UTSW 5 76559142 missense probably benign 0.21
X0018:Exoc1 UTSW 5 76567035 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACTTGTAAGTCAGCAAGCATAC -3'
(R):5'- CTTCAGCGTTAGAAATGGCG -3'

Sequencing Primer
(F):5'- AGCATACTAGACTGCATGCTTTCTG -3'
(R):5'- CGTTAGAAATGGCGCACTC -3'
Posted On 2015-07-07