Incidental Mutation 'R4413:Vmn2r50'
ID 328015
Institutional Source Beutler Lab
Gene Symbol Vmn2r50
Ensembl Gene ENSMUSG00000094606
Gene Name vomeronasal 2, receptor 50
Synonyms EG434117
MMRRC Submission 041136-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R4413 (G1)
Quality Score 148
Status Not validated
Chromosome 7
Chromosomal Location 10037235-10053178 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 10050308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 80 (F80V)
Ref Sequence ENSEMBL: ENSMUSP00000083478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074943] [ENSMUST00000086298]
AlphaFold E9PW61
Predicted Effect probably damaging
Transcript: ENSMUST00000074943
AA Change: F80V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074476
Gene: ENSMUSG00000094606
AA Change: F80V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1.4e-32 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 597 833 1.3e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086298
AA Change: F80V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083478
Gene: ENSMUSG00000094606
AA Change: F80V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 452 7e-31 PFAM
Pfam:NCD3G 496 549 5.3e-19 PFAM
Pfam:7tm_3 579 818 3.9e-78 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Exoc1 A G 5: 76,542,019 probably benign Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Mrm1 G T 11: 84,819,228 R49S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syn3 C A 10: 86,055,592 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 V402E probably damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Vmn2r50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Vmn2r50 APN 7 10037683 missense probably damaging 1.00
IGL01739:Vmn2r50 APN 7 10037437 missense probably damaging 1.00
IGL02351:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02358:Vmn2r50 APN 7 10053075 missense probably benign 0.01
IGL02871:Vmn2r50 APN 7 10047787 missense possibly damaging 0.91
IGL02962:Vmn2r50 APN 7 10050325 missense probably damaging 1.00
IGL03187:Vmn2r50 APN 7 10037441 missense probably damaging 1.00
IGL03346:Vmn2r50 APN 7 10046002 missense probably damaging 0.99
PIT4651001:Vmn2r50 UTSW 7 10037732 missense probably benign 0.30
R0530:Vmn2r50 UTSW 7 10047717 missense possibly damaging 0.82
R1291:Vmn2r50 UTSW 7 10037477 missense probably damaging 0.98
R1438:Vmn2r50 UTSW 7 10050135 nonsense probably null
R1713:Vmn2r50 UTSW 7 10037804 missense probably damaging 1.00
R1747:Vmn2r50 UTSW 7 10047678 missense probably benign 0.20
R1750:Vmn2r50 UTSW 7 10052988 missense possibly damaging 0.69
R1918:Vmn2r50 UTSW 7 10047683 missense probably benign 0.03
R2435:Vmn2r50 UTSW 7 10053099 missense probably benign 0.27
R2511:Vmn2r50 UTSW 7 10047713 missense possibly damaging 0.81
R3795:Vmn2r50 UTSW 7 10037924 missense probably benign 0.18
R4156:Vmn2r50 UTSW 7 10040382 missense probably benign 0.12
R4332:Vmn2r50 UTSW 7 10052995 missense probably benign 0.32
R4399:Vmn2r50 UTSW 7 10047907 missense possibly damaging 0.81
R4411:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4412:Vmn2r50 UTSW 7 10050308 missense probably damaging 0.99
R4645:Vmn2r50 UTSW 7 10037235 makesense probably null
R5151:Vmn2r50 UTSW 7 10053043 missense probably benign 0.00
R5175:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R5291:Vmn2r50 UTSW 7 10047825 missense probably damaging 1.00
R5457:Vmn2r50 UTSW 7 10047946 missense probably damaging 0.98
R5559:Vmn2r50 UTSW 7 10037326 missense probably damaging 1.00
R5579:Vmn2r50 UTSW 7 10050089 missense probably benign 0.00
R5711:Vmn2r50 UTSW 7 10040372 missense possibly damaging 0.81
R5759:Vmn2r50 UTSW 7 10047978 missense probably damaging 1.00
R6004:Vmn2r50 UTSW 7 10050059 missense probably benign 0.00
R6394:Vmn2r50 UTSW 7 10040326 missense probably damaging 1.00
R6488:Vmn2r50 UTSW 7 10037717 missense probably damaging 1.00
R6762:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R6995:Vmn2r50 UTSW 7 10046037 nonsense probably null
R6998:Vmn2r50 UTSW 7 10037757 missense probably benign 0.03
R7019:Vmn2r50 UTSW 7 10050245 missense probably benign 0.01
R7027:Vmn2r50 UTSW 7 10047612 missense probably damaging 1.00
R7231:Vmn2r50 UTSW 7 10053083 missense probably benign 0.04
R7343:Vmn2r50 UTSW 7 10050350 critical splice acceptor site probably null
R7554:Vmn2r50 UTSW 7 10050139 missense probably null 0.00
R7704:Vmn2r50 UTSW 7 10047738 missense probably benign 0.05
R7768:Vmn2r50 UTSW 7 10037371 missense probably damaging 0.99
R7773:Vmn2r50 UTSW 7 10037635 missense possibly damaging 0.70
R7975:Vmn2r50 UTSW 7 10037345 missense probably benign 0.39
R7987:Vmn2r50 UTSW 7 10038089 missense probably benign 0.14
R7996:Vmn2r50 UTSW 7 10047868 missense probably damaging 0.99
R8062:Vmn2r50 UTSW 7 10040313 critical splice donor site probably null
R8396:Vmn2r50 UTSW 7 10047712 nonsense probably null
R8466:Vmn2r50 UTSW 7 10050070 missense probably damaging 0.97
R8985:Vmn2r50 UTSW 7 10046047 missense probably damaging 1.00
R9068:Vmn2r50 UTSW 7 10038134 missense possibly damaging 0.46
R9155:Vmn2r50 UTSW 7 10047644 missense probably damaging 1.00
R9238:Vmn2r50 UTSW 7 10047576 missense probably benign 0.01
R9576:Vmn2r50 UTSW 7 10037263 missense probably benign
R9626:Vmn2r50 UTSW 7 10038033 nonsense probably null
R9631:Vmn2r50 UTSW 7 10053063 nonsense probably null
X0067:Vmn2r50 UTSW 7 10053027 missense probably damaging 0.99
Z1088:Vmn2r50 UTSW 7 10037500 missense possibly damaging 0.91
Z1088:Vmn2r50 UTSW 7 10046159 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTCCTCTAAGCAGAAACG -3'
(R):5'- TATGGGACCAACACCATCATG -3'

Sequencing Primer
(F):5'- CGAACACATACTCTCTTCATTACAG -3'
(R):5'- CACCATCATGAACTTTTAAAGTGC -3'
Posted On 2015-07-07