Incidental Mutation 'R4413:Nav2'
ID 328019
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Name neuron navigator 2
Synonyms Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission 041136-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.571) question?
Stock # R4413 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 48908716-49610090 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 49398109 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 91 (N91K)
Ref Sequence ENSEMBL: ENSMUSP00000139309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184124] [ENSMUST00000184945]
AlphaFold E9Q842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000064383
SMART Domains Protein: ENSMUSP00000066835
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
Blast:CH 18 79 2e-35 BLAST
PDB:2YRN|A 18 80 3e-33 PDB
SCOP:d1dxxa1 29 81 4e-15 SMART
low complexity region 94 102 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
coiled coil region 378 408 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
low complexity region 532 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064395
AA Change: N152K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: N152K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183659
AA Change: N91K

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: N91K

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184928
Predicted Effect probably benign
Transcript: ENSMUST00000184945
AA Change: N152K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: N152K

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207743
Meta Mutation Damage Score 0.0657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,246,114 (GRCm38) K144E probably benign Het
Bcdin3d A G 15: 99,470,733 (GRCm38) L195P probably damaging Het
Bltp1 A G 3: 36,958,681 (GRCm38) probably null Het
Col11a1 T A 3: 114,108,316 (GRCm38) S553R unknown Het
Cp A T 3: 19,966,353 (GRCm38) D170V probably damaging Het
Dnah17 C T 11: 118,025,168 (GRCm38) A4303T probably benign Het
Dpp4 G A 2: 62,387,140 (GRCm38) R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 (GRCm38) T78M probably damaging Het
Exoc1 A G 5: 76,542,019 (GRCm38) probably benign Het
Fbxl13 A T 5: 21,582,053 (GRCm38) C295* probably null Het
Gpsm1 G A 2: 26,319,831 (GRCm38) probably benign Het
Gstm4 T A 3: 108,043,328 (GRCm38) D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 (GRCm38) N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 (GRCm38) D27G probably damaging Het
Kcna4 T A 2: 107,295,373 (GRCm38) C151S probably benign Het
Lrrc10 A G 10: 117,045,814 (GRCm38) N131S probably damaging Het
Madd A G 2: 91,167,587 (GRCm38) S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 (GRCm38) V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 (GRCm38) noncoding transcript Het
Mrm1 G T 11: 84,819,228 (GRCm38) R49S possibly damaging Het
Noct C T 3: 51,250,335 (GRCm38) R365W probably damaging Het
Ntn1 C T 11: 68,385,910 (GRCm38) G71S probably damaging Het
Or10x1 T C 1: 174,369,474 (GRCm38) S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 (GRCm38) T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 (GRCm38) M52L probably benign Het
Saxo5 T A 8: 3,483,529 (GRCm38) H278Q probably damaging Het
Slc10a1 T C 12: 80,958,132 (GRCm38) N212S probably benign Het
Sohlh2 C A 3: 55,197,002 (GRCm38) T264K probably damaging Het
Srrm2 A G 17: 23,810,468 (GRCm38) probably benign Het
Syn3 C A 10: 86,055,592 (GRCm38) probably benign Het
Taf5 T A 19: 47,071,014 (GRCm38) V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 (GRCm38) V52L probably damaging Het
Tnk2 C T 16: 32,669,501 (GRCm38) R191C probably damaging Het
Ttn A G 2: 76,725,776 (GRCm38) I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 (GRCm38) V311E probably damaging Het
Usp7 C A 16: 8,708,914 (GRCm38) D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 (GRCm38) R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 (GRCm38) F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 (GRCm38) K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 (GRCm38) I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 (GRCm38) V402E probably damaging Het
Zfp462 A G 4: 55,012,672 (GRCm38) D1546G probably damaging Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49,571,194 (GRCm38) missense probably damaging 1.00
IGL01150:Nav2 APN 7 49,452,521 (GRCm38) missense probably benign 0.17
IGL01649:Nav2 APN 7 49,575,729 (GRCm38) missense probably damaging 1.00
IGL01662:Nav2 APN 7 49,571,209 (GRCm38) missense probably damaging 1.00
IGL02297:Nav2 APN 7 49,594,229 (GRCm38) missense probably damaging 0.98
IGL02313:Nav2 APN 7 49,558,773 (GRCm38) missense probably damaging 0.99
IGL02441:Nav2 APN 7 49,452,512 (GRCm38) missense probably damaging 1.00
IGL02472:Nav2 APN 7 49,546,041 (GRCm38) missense probably damaging 1.00
IGL02477:Nav2 APN 7 49,582,875 (GRCm38) missense probably damaging 0.99
IGL02725:Nav2 APN 7 49,565,095 (GRCm38) missense probably damaging 1.00
IGL02944:Nav2 APN 7 49,420,256 (GRCm38) missense probably damaging 0.99
IGL02953:Nav2 APN 7 49,548,423 (GRCm38) missense probably damaging 1.00
IGL03105:Nav2 APN 7 49,464,879 (GRCm38) missense probably damaging 1.00
IGL03234:Nav2 APN 7 49,462,008 (GRCm38) missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49,362,099 (GRCm38) missense probably damaging 1.00
IGL03294:Nav2 APN 7 49,491,457 (GRCm38) nonsense probably null
R0006:Nav2 UTSW 7 49,453,230 (GRCm38) missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49,570,714 (GRCm38) missense probably damaging 1.00
R0113:Nav2 UTSW 7 49,535,953 (GRCm38) missense probably damaging 1.00
R0306:Nav2 UTSW 7 49,545,903 (GRCm38) missense probably benign 0.01
R0346:Nav2 UTSW 7 49,604,585 (GRCm38) missense probably benign 0.11
R0539:Nav2 UTSW 7 49,461,938 (GRCm38) missense probably damaging 1.00
R0669:Nav2 UTSW 7 49,408,683 (GRCm38) missense probably damaging 1.00
R0785:Nav2 UTSW 7 49,420,333 (GRCm38) missense probably benign 0.06
R0970:Nav2 UTSW 7 49,584,153 (GRCm38) missense probably damaging 1.00
R1162:Nav2 UTSW 7 49,536,040 (GRCm38) splice site probably benign
R1274:Nav2 UTSW 7 49,604,430 (GRCm38) nonsense probably null
R1463:Nav2 UTSW 7 49,535,962 (GRCm38) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,362,204 (GRCm38) missense probably damaging 1.00
R1464:Nav2 UTSW 7 49,362,204 (GRCm38) missense probably damaging 1.00
R1536:Nav2 UTSW 7 49,545,934 (GRCm38) missense probably damaging 1.00
R1612:Nav2 UTSW 7 49,571,211 (GRCm38) missense probably damaging 1.00
R1638:Nav2 UTSW 7 49,452,465 (GRCm38) missense probably benign
R1731:Nav2 UTSW 7 49,548,174 (GRCm38) missense probably damaging 1.00
R1734:Nav2 UTSW 7 49,575,720 (GRCm38) missense probably damaging 1.00
R1865:Nav2 UTSW 7 49,548,195 (GRCm38) missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49,464,872 (GRCm38) missense probably damaging 1.00
R1997:Nav2 UTSW 7 49,548,471 (GRCm38) missense probably benign 0.16
R2061:Nav2 UTSW 7 49,598,897 (GRCm38) splice site probably benign
R2117:Nav2 UTSW 7 49,464,580 (GRCm38) missense probably benign 0.00
R2174:Nav2 UTSW 7 49,452,663 (GRCm38) missense probably damaging 0.99
R2182:Nav2 UTSW 7 49,597,254 (GRCm38) missense probably benign 0.38
R2251:Nav2 UTSW 7 49,453,277 (GRCm38) missense probably damaging 1.00
R2283:Nav2 UTSW 7 49,491,404 (GRCm38) missense probably damaging 1.00
R2343:Nav2 UTSW 7 49,598,817 (GRCm38) missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49,408,884 (GRCm38) missense probably benign
R2568:Nav2 UTSW 7 49,597,564 (GRCm38) missense probably damaging 1.00
R2656:Nav2 UTSW 7 49,545,942 (GRCm38) missense probably damaging 1.00
R2964:Nav2 UTSW 7 49,557,032 (GRCm38) missense probably damaging 1.00
R2966:Nav2 UTSW 7 49,557,032 (GRCm38) missense probably damaging 1.00
R3817:Nav2 UTSW 7 49,464,562 (GRCm38) missense probably benign 0.00
R3834:Nav2 UTSW 7 49,545,858 (GRCm38) missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49,597,231 (GRCm38) missense probably damaging 1.00
R4207:Nav2 UTSW 7 49,572,298 (GRCm38) splice site probably null
R4411:Nav2 UTSW 7 49,398,109 (GRCm38) missense probably benign 0.37
R4440:Nav2 UTSW 7 49,575,263 (GRCm38) splice site probably benign
R4440:Nav2 UTSW 7 49,552,037 (GRCm38) missense possibly damaging 0.86
R4454:Nav2 UTSW 7 49,548,544 (GRCm38) splice site probably null
R4729:Nav2 UTSW 7 49,452,819 (GRCm38) missense probably benign 0.17
R4801:Nav2 UTSW 7 49,545,852 (GRCm38) missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49,545,852 (GRCm38) missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49,409,001 (GRCm38) intron probably benign
R4887:Nav2 UTSW 7 49,548,434 (GRCm38) nonsense probably null
R4908:Nav2 UTSW 7 49,604,510 (GRCm38) missense probably damaging 1.00
R4952:Nav2 UTSW 7 49,304,540 (GRCm38) intron probably benign
R4965:Nav2 UTSW 7 49,552,877 (GRCm38) nonsense probably null
R5169:Nav2 UTSW 7 49,548,483 (GRCm38) nonsense probably null
R5224:Nav2 UTSW 7 49,551,725 (GRCm38) missense probably benign 0.00
R5249:Nav2 UTSW 7 49,535,913 (GRCm38) missense probably damaging 1.00
R5285:Nav2 UTSW 7 49,548,234 (GRCm38) missense probably damaging 1.00
R5314:Nav2 UTSW 7 49,408,692 (GRCm38) small deletion probably benign
R5320:Nav2 UTSW 7 49,491,373 (GRCm38) missense probably benign 0.00
R5377:Nav2 UTSW 7 49,589,160 (GRCm38) missense probably benign 0.02
R5471:Nav2 UTSW 7 49,548,169 (GRCm38) missense probably damaging 1.00
R5754:Nav2 UTSW 7 49,557,046 (GRCm38) missense probably damaging 1.00
R5832:Nav2 UTSW 7 49,548,069 (GRCm38) splice site probably null
R5884:Nav2 UTSW 7 49,597,169 (GRCm38) nonsense probably null
R5921:Nav2 UTSW 7 49,304,576 (GRCm38) intron probably benign
R6180:Nav2 UTSW 7 49,458,167 (GRCm38) missense probably benign 0.39
R6208:Nav2 UTSW 7 49,564,103 (GRCm38) missense probably damaging 0.99
R6373:Nav2 UTSW 7 49,453,175 (GRCm38) missense probably damaging 1.00
R6450:Nav2 UTSW 7 49,594,366 (GRCm38) missense probably damaging 1.00
R6522:Nav2 UTSW 7 49,597,533 (GRCm38) missense probably damaging 1.00
R6626:Nav2 UTSW 7 49,594,352 (GRCm38) missense probably damaging 1.00
R6695:Nav2 UTSW 7 49,464,904 (GRCm38) missense probably benign 0.04
R6705:Nav2 UTSW 7 49,551,916 (GRCm38) missense probably damaging 1.00
R6842:Nav2 UTSW 7 49,458,169 (GRCm38) missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49,491,456 (GRCm38) missense probably benign 0.14
R7287:Nav2 UTSW 7 49,420,328 (GRCm38) missense probably benign 0.01
R7312:Nav2 UTSW 7 49,461,924 (GRCm38) missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49,548,289 (GRCm38) missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49,551,773 (GRCm38) missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49,554,203 (GRCm38) splice site probably null
R7451:Nav2 UTSW 7 49,552,829 (GRCm38) splice site probably null
R7545:Nav2 UTSW 7 49,582,857 (GRCm38) missense probably damaging 1.00
R7706:Nav2 UTSW 7 49,594,319 (GRCm38) missense probably benign 0.35
R7730:Nav2 UTSW 7 49,572,397 (GRCm38) missense probably damaging 1.00
R7812:Nav2 UTSW 7 49,597,173 (GRCm38) missense probably benign 0.13
R8097:Nav2 UTSW 7 49,587,777 (GRCm38) missense probably damaging 1.00
R8110:Nav2 UTSW 7 49,551,950 (GRCm38) nonsense probably null
R8119:Nav2 UTSW 7 49,453,484 (GRCm38) missense probably damaging 0.99
R8298:Nav2 UTSW 7 49,554,261 (GRCm38) critical splice donor site probably null
R8306:Nav2 UTSW 7 49,546,017 (GRCm38) missense probably benign 0.33
R8331:Nav2 UTSW 7 49,452,623 (GRCm38) missense probably benign
R8402:Nav2 UTSW 7 49,453,437 (GRCm38) missense probably benign 0.43
R8421:Nav2 UTSW 7 49,452,521 (GRCm38) missense probably benign
R8478:Nav2 UTSW 7 49,461,985 (GRCm38) missense probably damaging 0.99
R8724:Nav2 UTSW 7 49,491,436 (GRCm38) missense possibly damaging 0.82
R8753:Nav2 UTSW 7 49,452,572 (GRCm38) missense probably benign
R8835:Nav2 UTSW 7 49,598,803 (GRCm38) missense possibly damaging 0.83
R8933:Nav2 UTSW 7 49,461,957 (GRCm38) missense probably damaging 1.00
R8957:Nav2 UTSW 7 49,571,216 (GRCm38) missense probably damaging 1.00
R9069:Nav2 UTSW 7 49,558,813 (GRCm38) missense probably damaging 0.99
R9095:Nav2 UTSW 7 49,604,545 (GRCm38) missense probably damaging 1.00
R9223:Nav2 UTSW 7 49,552,851 (GRCm38) missense probably damaging 1.00
R9261:Nav2 UTSW 7 49,597,156 (GRCm38) missense probably damaging 1.00
X0023:Nav2 UTSW 7 49,547,899 (GRCm38) missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49,594,223 (GRCm38) missense probably benign 0.01
Z1177:Nav2 UTSW 7 49,452,761 (GRCm38) missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCGTTTTGAGAGTCCTAACCTC -3'
(R):5'- ACACAGGGCTGCATTCTTAG -3'

Sequencing Primer
(F):5'- TGAGAGTCCTAACCTCGTCGC -3'
(R):5'- AGTAACGTCAACTGTGCTGG -3'
Posted On 2015-07-07