Incidental Mutation 'R4413:Syn3'
ID328022
Institutional Source Beutler Lab
Gene Symbol Syn3
Ensembl Gene ENSMUSG00000059602
Gene Namesynapsin III
SynonymsSynapsin IIIa
MMRRC Submission 041136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4413 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86055125-86498896 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 86055592 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120638] [ENSMUST00000130320]
Predicted Effect unknown
Transcript: ENSMUST00000120638
AA Change: E560D
SMART Domains Protein: ENSMUSP00000113720
Gene: ENSMUSG00000059602
AA Change: E560D

DomainStartEndE-ValueType
Pfam:Synapsin_N 1 32 8.7e-22 PFAM
low complexity region 47 66 N/A INTRINSIC
low complexity region 80 88 N/A INTRINSIC
Pfam:Synapsin 89 190 1.8e-46 PFAM
Pfam:Synapsin_C 192 394 6.8e-141 PFAM
low complexity region 418 485 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130320
SMART Domains Protein: ENSMUSP00000120840
Gene: ENSMUSG00000001786

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 78 7e-6 SMART
Blast:UBQ 1 79 6e-30 BLAST
Pfam:PI31_Prot_N 188 323 4.7e-20 PFAM
Pfam:F-box 331 378 9.7e-6 PFAM
Pfam:F-box-like 333 379 9.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143319
Meta Mutation Damage Score 0.1098 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. The protein encoded by this gene shares the synapsin family domain model, with domains A, C, and E exhibiting the highest degree of conservation. The protein contains a unique domain J, located between domains C and E. Based on this gene's localization to 22q12.3, a possible schizophrenia susceptibility locus, and the established neurobiological roles of the synapsins, this family member may represent a candidate gene for schizophrenia. The TIMP3 gene is located within an intron of this gene and is transcribed in the opposite direction. Alternative splicing of this gene results in multiple splice variants that encode different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display altered neurotransmitter release, reduced synaptic depression, and a specific delay in early axon outgrowth in cultured hippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Exoc1 A G 5: 76,542,019 probably benign Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Mrm1 G T 11: 84,819,228 R49S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 V402E probably damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Syn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Syn3 APN 10 86354416 missense probably damaging 1.00
IGL02391:Syn3 APN 10 86064906 missense probably benign 0.22
IGL02598:Syn3 APN 10 86467199 missense probably damaging 0.99
IGL03007:Syn3 APN 10 86064914 missense possibly damaging 0.57
IGL03379:Syn3 APN 10 86064872 missense possibly damaging 0.80
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R0234:Syn3 UTSW 10 86448886 missense possibly damaging 0.64
R1577:Syn3 UTSW 10 86448864 critical splice donor site probably null
R1597:Syn3 UTSW 10 86135044 missense probably benign 0.16
R1699:Syn3 UTSW 10 86080211 missense probably damaging 1.00
R1916:Syn3 UTSW 10 86354344 critical splice donor site probably null
R2006:Syn3 UTSW 10 86073233 missense probably benign 0.20
R2025:Syn3 UTSW 10 86466982 missense probably damaging 0.97
R4904:Syn3 UTSW 10 86467086 missense possibly damaging 0.91
R5050:Syn3 UTSW 10 86407668 missense probably benign 0.05
R5286:Syn3 UTSW 10 86351564 missense possibly damaging 0.93
R5449:Syn3 UTSW 10 86351570 missense probably damaging 1.00
R5507:Syn3 UTSW 10 86080226 missense probably benign 0.01
R5792:Syn3 UTSW 10 86294628 makesense probably null
R6525:Syn3 UTSW 10 86467052 missense probably damaging 0.99
R6605:Syn3 UTSW 10 86057564 missense unknown
R7000:Syn3 UTSW 10 86080252 missense probably damaging 1.00
R7619:Syn3 UTSW 10 86057564 missense unknown
R7661:Syn3 UTSW 10 86069076 missense probably damaging 1.00
R7710:Syn3 UTSW 10 86407670 missense probably damaging 0.98
R7730:Syn3 UTSW 10 86448909 missense probably benign 0.05
R7798:Syn3 UTSW 10 86080253 missense probably damaging 1.00
R7819:Syn3 UTSW 10 86055540 unclassified probably benign
R7899:Syn3 UTSW 10 86064929 missense possibly damaging 0.94
R7982:Syn3 UTSW 10 86064929 missense possibly damaging 0.94
X0023:Syn3 UTSW 10 86354477 missense probably benign 0.35
Z1177:Syn3 UTSW 10 86080209 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTAGATCATCAGTTCCTGC -3'
(R):5'- GCAATGCCTGATTTCTGGTC -3'

Sequencing Primer
(F):5'- AGATCATCAGTTCCTGCATCTTTAGG -3'
(R):5'- ATCTTTTAATGACCCCGTGCTCAG -3'
Posted On2015-07-07