Incidental Mutation 'R4413:Dusp6'
ID 328023
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Name dual specificity phosphatase 6
Synonyms 1300019I03Rik, MKP-3, PYST1, MKP3
MMRRC Submission 041136-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R4413 (G1)
Quality Score 215
Status Validated
Chromosome 10
Chromosomal Location 99099093-99103351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 99099786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 78 (T78M)
Ref Sequence ENSEMBL: ENSMUSP00000151438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
AlphaFold Q9DBB1
Predicted Effect probably benign
Transcript: ENSMUST00000020118
AA Change: T78M

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: T78M

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220218
Predicted Effect probably damaging
Transcript: ENSMUST00000220291
AA Change: T78M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.1154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,296,114 (GRCm39) K144E probably benign Het
Bcdin3d A G 15: 99,368,614 (GRCm39) L195P probably damaging Het
Bltp1 A G 3: 37,012,830 (GRCm39) probably null Het
Col11a1 T A 3: 113,901,965 (GRCm39) S553R unknown Het
Cp A T 3: 20,020,517 (GRCm39) D170V probably damaging Het
Dnah17 C T 11: 117,915,994 (GRCm39) A4303T probably benign Het
Dpp4 G A 2: 62,217,484 (GRCm39) R38C possibly damaging Het
Exoc1 A G 5: 76,689,866 (GRCm39) probably benign Het
Fbxl13 A T 5: 21,787,051 (GRCm39) C295* probably null Het
Gpsm1 G A 2: 26,209,843 (GRCm39) probably benign Het
Gstm4 T A 3: 107,950,644 (GRCm39) D85V possibly damaging Het
Hectd4 A G 5: 121,488,544 (GRCm39) N3612D possibly damaging Het
Izumo3 T C 4: 92,035,136 (GRCm39) D27G probably damaging Het
Kcna4 T A 2: 107,125,718 (GRCm39) C151S probably benign Het
Lrrc10 A G 10: 116,881,719 (GRCm39) N131S probably damaging Het
Madd A G 2: 90,997,932 (GRCm39) S699P probably damaging Het
Mcpt4 A T 14: 56,297,993 (GRCm39) V186D probably damaging Het
Mrgprx3-ps T C 7: 46,959,746 (GRCm39) noncoding transcript Het
Mrm1 G T 11: 84,710,054 (GRCm39) R49S possibly damaging Het
Nav2 T A 7: 49,047,857 (GRCm39) N91K probably benign Het
Noct C T 3: 51,157,756 (GRCm39) R365W probably damaging Het
Ntn1 C T 11: 68,276,736 (GRCm39) G71S probably damaging Het
Or10x1 T C 1: 174,197,040 (GRCm39) S186P probably damaging Het
Plekhg3 A C 12: 76,624,538 (GRCm39) T1127P probably damaging Het
Rhbdl2 A T 4: 123,703,880 (GRCm39) M52L probably benign Het
Saxo5 T A 8: 3,533,529 (GRCm39) H278Q probably damaging Het
Slc10a1 T C 12: 81,004,906 (GRCm39) N212S probably benign Het
Sohlh2 C A 3: 55,104,423 (GRCm39) T264K probably damaging Het
Srrm2 A G 17: 24,029,442 (GRCm39) probably benign Het
Syn3 C A 10: 85,891,456 (GRCm39) probably benign Het
Taf5 T A 19: 47,059,453 (GRCm39) V199D probably damaging Het
Tas2r136 C A 6: 132,754,972 (GRCm39) V52L probably damaging Het
Tnk2 C T 16: 32,488,319 (GRCm39) R191C probably damaging Het
Ttn A G 2: 76,556,120 (GRCm39) I21968T probably damaging Het
Ubxn6 A T 17: 56,376,303 (GRCm39) V311E probably damaging Het
Usp7 C A 16: 8,526,778 (GRCm39) D187Y probably damaging Het
Vmn1r115 C T 7: 20,578,207 (GRCm39) R235K probably benign Het
Vmn2r50 A C 7: 9,784,235 (GRCm39) F80V probably damaging Het
Vmn2r58 T A 7: 41,511,360 (GRCm39) K481M possibly damaging Het
Vmn2r86 A G 10: 130,288,469 (GRCm39) I344T possibly damaging Het
Vmn2r99 T A 17: 19,599,522 (GRCm39) V402E probably damaging Het
Zfp462 A G 4: 55,012,672 (GRCm39) D1546G probably damaging Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99,101,881 (GRCm39) missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99,102,044 (GRCm39) missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99,100,628 (GRCm39) missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99,102,156 (GRCm39) missense probably damaging 0.97
R1134:Dusp6 UTSW 10 99,100,816 (GRCm39) missense probably damaging 0.98
R1695:Dusp6 UTSW 10 99,099,555 (GRCm39) start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99,099,686 (GRCm39) missense probably damaging 1.00
R2899:Dusp6 UTSW 10 99,099,707 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R4501:Dusp6 UTSW 10 99,100,457 (GRCm39) missense probably benign 0.41
R5175:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R5381:Dusp6 UTSW 10 99,102,129 (GRCm39) missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99,102,103 (GRCm39) missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99,099,927 (GRCm39) missense probably benign 0.01
R7398:Dusp6 UTSW 10 99,100,740 (GRCm39) missense probably damaging 1.00
R8075:Dusp6 UTSW 10 99,100,810 (GRCm39) missense possibly damaging 0.63
R8491:Dusp6 UTSW 10 99,102,081 (GRCm39) missense possibly damaging 0.66
R8826:Dusp6 UTSW 10 99,099,469 (GRCm39) start gained probably benign
R9084:Dusp6 UTSW 10 99,099,692 (GRCm39) missense probably benign 0.13
R9125:Dusp6 UTSW 10 99,102,074 (GRCm39) nonsense probably null
R9389:Dusp6 UTSW 10 99,099,839 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATAGATACGCTCAGACCCGTGC -3'
(R):5'- ACATTTTCCCCAGCCTGCAG -3'

Sequencing Primer
(F):5'- TCGGAAATGGCGATCTGC -3'
(R):5'- GGGGCGCACAACATACCTTC -3'
Posted On 2015-07-07