Incidental Mutation 'R4413:Ntn1'
ID 328026
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission 041136-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.673) question?
Stock # R4413 (G1)
Quality Score 138
Status Validated
Chromosome 11
Chromosomal Location 68100190-68277652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 68276736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 71 (G71S)
Ref Sequence ENSEMBL: ENSMUSP00000121193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674] [ENSMUST00000135141]
AlphaFold O09118
Predicted Effect probably damaging
Transcript: ENSMUST00000021284
AA Change: G71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: G71S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108674
AA Change: G71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: G71S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135141
AA Change: G71S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121193
Gene: ENSMUSG00000020902
AA Change: G71S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 159 6.8e-15 SMART
Meta Mutation Damage Score 0.3804 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,296,114 (GRCm39) K144E probably benign Het
Bcdin3d A G 15: 99,368,614 (GRCm39) L195P probably damaging Het
Bltp1 A G 3: 37,012,830 (GRCm39) probably null Het
Col11a1 T A 3: 113,901,965 (GRCm39) S553R unknown Het
Cp A T 3: 20,020,517 (GRCm39) D170V probably damaging Het
Dnah17 C T 11: 117,915,994 (GRCm39) A4303T probably benign Het
Dpp4 G A 2: 62,217,484 (GRCm39) R38C possibly damaging Het
Dusp6 C T 10: 99,099,786 (GRCm39) T78M probably damaging Het
Exoc1 A G 5: 76,689,866 (GRCm39) probably benign Het
Fbxl13 A T 5: 21,787,051 (GRCm39) C295* probably null Het
Gpsm1 G A 2: 26,209,843 (GRCm39) probably benign Het
Gstm4 T A 3: 107,950,644 (GRCm39) D85V possibly damaging Het
Hectd4 A G 5: 121,488,544 (GRCm39) N3612D possibly damaging Het
Izumo3 T C 4: 92,035,136 (GRCm39) D27G probably damaging Het
Kcna4 T A 2: 107,125,718 (GRCm39) C151S probably benign Het
Lrrc10 A G 10: 116,881,719 (GRCm39) N131S probably damaging Het
Madd A G 2: 90,997,932 (GRCm39) S699P probably damaging Het
Mcpt4 A T 14: 56,297,993 (GRCm39) V186D probably damaging Het
Mrgprx3-ps T C 7: 46,959,746 (GRCm39) noncoding transcript Het
Mrm1 G T 11: 84,710,054 (GRCm39) R49S possibly damaging Het
Nav2 T A 7: 49,047,857 (GRCm39) N91K probably benign Het
Noct C T 3: 51,157,756 (GRCm39) R365W probably damaging Het
Or10x1 T C 1: 174,197,040 (GRCm39) S186P probably damaging Het
Plekhg3 A C 12: 76,624,538 (GRCm39) T1127P probably damaging Het
Rhbdl2 A T 4: 123,703,880 (GRCm39) M52L probably benign Het
Saxo5 T A 8: 3,533,529 (GRCm39) H278Q probably damaging Het
Slc10a1 T C 12: 81,004,906 (GRCm39) N212S probably benign Het
Sohlh2 C A 3: 55,104,423 (GRCm39) T264K probably damaging Het
Srrm2 A G 17: 24,029,442 (GRCm39) probably benign Het
Syn3 C A 10: 85,891,456 (GRCm39) probably benign Het
Taf5 T A 19: 47,059,453 (GRCm39) V199D probably damaging Het
Tas2r136 C A 6: 132,754,972 (GRCm39) V52L probably damaging Het
Tnk2 C T 16: 32,488,319 (GRCm39) R191C probably damaging Het
Ttn A G 2: 76,556,120 (GRCm39) I21968T probably damaging Het
Ubxn6 A T 17: 56,376,303 (GRCm39) V311E probably damaging Het
Usp7 C A 16: 8,526,778 (GRCm39) D187Y probably damaging Het
Vmn1r115 C T 7: 20,578,207 (GRCm39) R235K probably benign Het
Vmn2r50 A C 7: 9,784,235 (GRCm39) F80V probably damaging Het
Vmn2r58 T A 7: 41,511,360 (GRCm39) K481M possibly damaging Het
Vmn2r86 A G 10: 130,288,469 (GRCm39) I344T possibly damaging Het
Vmn2r99 T A 17: 19,599,522 (GRCm39) V402E probably damaging Het
Zfp462 A G 4: 55,012,672 (GRCm39) D1546G probably damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68,117,445 (GRCm39) splice site probably benign
IGL00972:Ntn1 APN 11 68,104,098 (GRCm39) missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68,117,430 (GRCm39) missense probably benign 0.00
IGL01731:Ntn1 APN 11 68,276,244 (GRCm39) missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68,104,089 (GRCm39) missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68,168,356 (GRCm39) missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68,276,295 (GRCm39) missense probably benign 0.06
R0363:Ntn1 UTSW 11 68,276,369 (GRCm39) missense probably benign 0.44
R1201:Ntn1 UTSW 11 68,104,052 (GRCm39) missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68,103,959 (GRCm39) small deletion probably benign
R1913:Ntn1 UTSW 11 68,104,011 (GRCm39) missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68,276,120 (GRCm39) missense probably benign 0.12
R2248:Ntn1 UTSW 11 68,168,398 (GRCm39) missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68,276,438 (GRCm39) missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68,276,690 (GRCm39) missense probably benign 0.00
R3830:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4871:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4952:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R5001:Ntn1 UTSW 11 68,151,358 (GRCm39) missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68,276,538 (GRCm39) missense probably benign 0.37
R6217:Ntn1 UTSW 11 68,104,158 (GRCm39) missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68,104,025 (GRCm39) missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68,276,576 (GRCm39) missense probably benign 0.00
R7172:Ntn1 UTSW 11 68,276,493 (GRCm39) missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68,276,915 (GRCm39) missense probably benign 0.15
R8314:Ntn1 UTSW 11 68,276,450 (GRCm39) missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68,117,397 (GRCm39) missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68,276,013 (GRCm39) missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68,148,485 (GRCm39) intron probably benign
R9697:Ntn1 UTSW 11 68,168,356 (GRCm39) missense probably damaging 1.00
R9752:Ntn1 UTSW 11 68,276,712 (GRCm39) missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68,276,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGGTAGTTCTCGGACTG -3'
(R):5'- TTCAGGTTTGGAAGCCCCTG -3'

Sequencing Primer
(F):5'- TAGTTCTCGGACTGCCAGCAC -3'
(R):5'- TGGCCACAGCATGATGC -3'
Posted On 2015-07-07