Incidental Mutation 'R4413:Mrm1'
ID 328027
Institutional Source Beutler Lab
Gene Symbol Mrm1
Ensembl Gene ENSMUSG00000018405
Gene Name mitochondrial rRNA methyltransferase 1
Synonyms A530065E19Rik
MMRRC Submission 041136-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.100) question?
Stock # R4413 (G1)
Quality Score 201
Status Validated
Chromosome 11
Chromosomal Location 84703887-84710341 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84710054 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 49 (R49S)
Ref Sequence ENSEMBL: ENSMUSP00000018549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018549] [ENSMUST00000047560] [ENSMUST00000151496]
AlphaFold Q99J25
Predicted Effect possibly damaging
Transcript: ENSMUST00000018549
AA Change: R49S

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018549
Gene: ENSMUSG00000018405
AA Change: R49S

DomainStartEndE-ValueType
SpoU_sub_bind 49 127 3.31e-11 SMART
Pfam:SpoU_methylase 143 299 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047560
SMART Domains Protein: ENSMUSP00000043467
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 214 1.4e-46 PFAM
Pfam:KR 13 154 1.7e-11 PFAM
Pfam:Epimerase 14 251 4.8e-7 PFAM
Pfam:adh_short_C2 18 245 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144104
Predicted Effect probably benign
Transcript: ENSMUST00000151496
SMART Domains Protein: ENSMUSP00000122267
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 49 6.3e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,296,114 (GRCm39) K144E probably benign Het
Bcdin3d A G 15: 99,368,614 (GRCm39) L195P probably damaging Het
Bltp1 A G 3: 37,012,830 (GRCm39) probably null Het
Col11a1 T A 3: 113,901,965 (GRCm39) S553R unknown Het
Cp A T 3: 20,020,517 (GRCm39) D170V probably damaging Het
Dnah17 C T 11: 117,915,994 (GRCm39) A4303T probably benign Het
Dpp4 G A 2: 62,217,484 (GRCm39) R38C possibly damaging Het
Dusp6 C T 10: 99,099,786 (GRCm39) T78M probably damaging Het
Exoc1 A G 5: 76,689,866 (GRCm39) probably benign Het
Fbxl13 A T 5: 21,787,051 (GRCm39) C295* probably null Het
Gpsm1 G A 2: 26,209,843 (GRCm39) probably benign Het
Gstm4 T A 3: 107,950,644 (GRCm39) D85V possibly damaging Het
Hectd4 A G 5: 121,488,544 (GRCm39) N3612D possibly damaging Het
Izumo3 T C 4: 92,035,136 (GRCm39) D27G probably damaging Het
Kcna4 T A 2: 107,125,718 (GRCm39) C151S probably benign Het
Lrrc10 A G 10: 116,881,719 (GRCm39) N131S probably damaging Het
Madd A G 2: 90,997,932 (GRCm39) S699P probably damaging Het
Mcpt4 A T 14: 56,297,993 (GRCm39) V186D probably damaging Het
Mrgprx3-ps T C 7: 46,959,746 (GRCm39) noncoding transcript Het
Nav2 T A 7: 49,047,857 (GRCm39) N91K probably benign Het
Noct C T 3: 51,157,756 (GRCm39) R365W probably damaging Het
Ntn1 C T 11: 68,276,736 (GRCm39) G71S probably damaging Het
Or10x1 T C 1: 174,197,040 (GRCm39) S186P probably damaging Het
Plekhg3 A C 12: 76,624,538 (GRCm39) T1127P probably damaging Het
Rhbdl2 A T 4: 123,703,880 (GRCm39) M52L probably benign Het
Saxo5 T A 8: 3,533,529 (GRCm39) H278Q probably damaging Het
Slc10a1 T C 12: 81,004,906 (GRCm39) N212S probably benign Het
Sohlh2 C A 3: 55,104,423 (GRCm39) T264K probably damaging Het
Srrm2 A G 17: 24,029,442 (GRCm39) probably benign Het
Syn3 C A 10: 85,891,456 (GRCm39) probably benign Het
Taf5 T A 19: 47,059,453 (GRCm39) V199D probably damaging Het
Tas2r136 C A 6: 132,754,972 (GRCm39) V52L probably damaging Het
Tnk2 C T 16: 32,488,319 (GRCm39) R191C probably damaging Het
Ttn A G 2: 76,556,120 (GRCm39) I21968T probably damaging Het
Ubxn6 A T 17: 56,376,303 (GRCm39) V311E probably damaging Het
Usp7 C A 16: 8,526,778 (GRCm39) D187Y probably damaging Het
Vmn1r115 C T 7: 20,578,207 (GRCm39) R235K probably benign Het
Vmn2r50 A C 7: 9,784,235 (GRCm39) F80V probably damaging Het
Vmn2r58 T A 7: 41,511,360 (GRCm39) K481M possibly damaging Het
Vmn2r86 A G 10: 130,288,469 (GRCm39) I344T possibly damaging Het
Vmn2r99 T A 17: 19,599,522 (GRCm39) V402E probably damaging Het
Zfp462 A G 4: 55,012,672 (GRCm39) D1546G probably damaging Het
Other mutations in Mrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Mrm1 UTSW 11 84,709,996 (GRCm39) missense possibly damaging 0.73
R0257:Mrm1 UTSW 11 84,705,649 (GRCm39) splice site probably benign
R0381:Mrm1 UTSW 11 84,709,509 (GRCm39) missense possibly damaging 0.91
R0563:Mrm1 UTSW 11 84,705,539 (GRCm39) missense probably damaging 1.00
R0715:Mrm1 UTSW 11 84,705,639 (GRCm39) splice site probably benign
R1710:Mrm1 UTSW 11 84,709,518 (GRCm39) missense probably damaging 1.00
R4402:Mrm1 UTSW 11 84,709,915 (GRCm39) missense probably damaging 1.00
R5266:Mrm1 UTSW 11 84,710,086 (GRCm39) missense possibly damaging 0.58
R5930:Mrm1 UTSW 11 84,710,018 (GRCm39) missense probably damaging 1.00
R7833:Mrm1 UTSW 11 84,709,469 (GRCm39) missense probably damaging 1.00
R9487:Mrm1 UTSW 11 84,705,531 (GRCm39) missense probably damaging 1.00
R9504:Mrm1 UTSW 11 84,710,132 (GRCm39) missense probably damaging 1.00
R9680:Mrm1 UTSW 11 84,710,144 (GRCm39) missense possibly damaging 0.92
X0017:Mrm1 UTSW 11 84,705,749 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGATGACTCTGTCTACGCCGAG -3'
(R):5'- AGCTGTCTGTCAGTGGAGTCTC -3'

Sequencing Primer
(F):5'- GCACAAGGCATCCAGTTTCTG -3'
(R):5'- TCAGTGGAGTCTCGGGCG -3'
Posted On 2015-07-07