Incidental Mutation 'R4413:Mrm1'
ID328027
Institutional Source Beutler Lab
Gene Symbol Mrm1
Ensembl Gene ENSMUSG00000018405
Gene Namemitochondrial rRNA methyltransferase 1
Synonyms
MMRRC Submission 041136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R4413 (G1)
Quality Score201
Status Validated
Chromosome11
Chromosomal Location84813061-84819515 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84819228 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 49 (R49S)
Ref Sequence ENSEMBL: ENSMUSP00000018549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018549] [ENSMUST00000047560] [ENSMUST00000151496]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018549
AA Change: R49S

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018549
Gene: ENSMUSG00000018405
AA Change: R49S

DomainStartEndE-ValueType
SpoU_sub_bind 49 127 3.31e-11 SMART
Pfam:SpoU_methylase 143 299 3.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047560
SMART Domains Protein: ENSMUSP00000043467
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 214 1.4e-46 PFAM
Pfam:KR 13 154 1.7e-11 PFAM
Pfam:Epimerase 14 251 4.8e-7 PFAM
Pfam:adh_short_C2 18 245 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144104
Predicted Effect probably benign
Transcript: ENSMUST00000151496
SMART Domains Protein: ENSMUSP00000122267
Gene: ENSMUSG00000034449

DomainStartEndE-ValueType
Pfam:adh_short 12 49 6.3e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Exoc1 A G 5: 76,542,019 probably benign Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mcpt4 A T 14: 56,060,536 V186D probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syn3 C A 10: 86,055,592 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 V402E probably damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Mrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0226:Mrm1 UTSW 11 84819170 missense possibly damaging 0.73
R0257:Mrm1 UTSW 11 84814823 splice site probably benign
R0381:Mrm1 UTSW 11 84818683 missense possibly damaging 0.91
R0563:Mrm1 UTSW 11 84814713 missense probably damaging 1.00
R0715:Mrm1 UTSW 11 84814813 splice site probably benign
R1710:Mrm1 UTSW 11 84818692 missense probably damaging 1.00
R4402:Mrm1 UTSW 11 84819089 missense probably damaging 1.00
R5266:Mrm1 UTSW 11 84819260 missense possibly damaging 0.58
R5930:Mrm1 UTSW 11 84819192 missense probably damaging 1.00
R7833:Mrm1 UTSW 11 84818643 missense probably damaging 1.00
X0017:Mrm1 UTSW 11 84814923 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGATGACTCTGTCTACGCCGAG -3'
(R):5'- AGCTGTCTGTCAGTGGAGTCTC -3'

Sequencing Primer
(F):5'- GCACAAGGCATCCAGTTTCTG -3'
(R):5'- TCAGTGGAGTCTCGGGCG -3'
Posted On2015-07-07