Incidental Mutation 'R4413:Mcpt4'
ID328031
Institutional Source Beutler Lab
Gene Symbol Mcpt4
Ensembl Gene ENSMUSG00000061068
Gene Namemast cell protease 4
SynonymsMMCP-4B, Mcp4, myonase, Mcp-4, MMCP-4, MMCP-4A
MMRRC Submission 041136-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4413 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56059629-56062313 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56060536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 186 (V186D)
Ref Sequence ENSEMBL: ENSMUSP00000038103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043249]
Predicted Effect probably damaging
Transcript: ENSMUST00000043249
AA Change: V186D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038103
Gene: ENSMUSG00000061068
AA Change: V186D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 20 239 6.1e-88 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (42/45)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this locus affects thrombin regulation and fibronectin turnover. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,958,681 probably null Het
Adprhl1 T C 8: 13,246,114 K144E probably benign Het
Bcdin3d A G 15: 99,470,733 L195P probably damaging Het
Col11a1 T A 3: 114,108,316 S553R unknown Het
Cp A T 3: 19,966,353 D170V probably damaging Het
Dnah17 C T 11: 118,025,168 A4303T probably benign Het
Dpp4 G A 2: 62,387,140 R38C possibly damaging Het
Dusp6 C T 10: 99,263,924 T78M probably damaging Het
Exoc1 A G 5: 76,542,019 probably benign Het
Fbxl13 A T 5: 21,582,053 C295* probably null Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Gstm4 T A 3: 108,043,328 D85V possibly damaging Het
Hectd4 A G 5: 121,350,481 N3612D possibly damaging Het
Izumo3 T C 4: 92,146,899 D27G probably damaging Het
Kcna4 T A 2: 107,295,373 C151S probably benign Het
Lrrc10 A G 10: 117,045,814 N131S probably damaging Het
Madd A G 2: 91,167,587 S699P probably damaging Het
Mrgprx3-ps T C 7: 47,309,998 noncoding transcript Het
Mrm1 G T 11: 84,819,228 R49S possibly damaging Het
Nav2 T A 7: 49,398,109 N91K probably benign Het
Noct C T 3: 51,250,335 R365W probably damaging Het
Ntn1 C T 11: 68,385,910 G71S probably damaging Het
Olfr417 T C 1: 174,369,474 S186P probably damaging Het
Plekhg3 A C 12: 76,577,764 T1127P probably damaging Het
Rhbdl2 A T 4: 123,810,087 M52L probably benign Het
Slc10a1 T C 12: 80,958,132 N212S probably benign Het
Sohlh2 C A 3: 55,197,002 T264K probably damaging Het
Srrm2 A G 17: 23,810,468 probably benign Het
Syn3 C A 10: 86,055,592 probably benign Het
Taf5 T A 19: 47,071,014 V199D probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tex45 T A 8: 3,483,529 H278Q probably damaging Het
Tnk2 C T 16: 32,669,501 R191C probably damaging Het
Ttn A G 2: 76,725,776 I21968T probably damaging Het
Ubxn6 A T 17: 56,069,303 V311E probably damaging Het
Usp7 C A 16: 8,708,914 D187Y probably damaging Het
Vmn1r115 C T 7: 20,844,282 R235K probably benign Het
Vmn2r50 A C 7: 10,050,308 F80V probably damaging Het
Vmn2r58 T A 7: 41,861,936 K481M possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r99 T A 17: 19,379,260 V402E probably damaging Het
Zfp462 A G 4: 55,012,672 D1546G probably damaging Het
Other mutations in Mcpt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Mcpt4 APN 14 56061030 missense probably benign
IGL02733:Mcpt4 APN 14 56060667 missense probably benign 0.03
R0622:Mcpt4 UTSW 14 56060662 missense probably benign 0.06
R1699:Mcpt4 UTSW 14 56059959 makesense probably null
R4298:Mcpt4 UTSW 14 56060987 missense possibly damaging 0.70
R5191:Mcpt4 UTSW 14 56061009 missense probably benign 0.00
R5378:Mcpt4 UTSW 14 56062293 utr 5 prime probably null
R6650:Mcpt4 UTSW 14 56060633 missense possibly damaging 0.82
R7062:Mcpt4 UTSW 14 56060668 missense probably benign 0.09
R7730:Mcpt4 UTSW 14 56059971 missense probably benign
R7809:Mcpt4 UTSW 14 56060684 missense possibly damaging 0.77
X0019:Mcpt4 UTSW 14 56062272 start codon destroyed probably null 0.94
Z1088:Mcpt4 UTSW 14 56060510 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTTGGCATAGGCAGATG -3'
(R):5'- AGACTCCCTCTGTGAATGTAATTCC -3'

Sequencing Primer
(F):5'- ACAAGAGGGATAATTTCAGTTCGC -3'
(R):5'- GTGAATGTAATTCCTCTGCCTCG -3'
Posted On2015-07-07