Incidental Mutation 'R4414:Acss1'
ID328048
Institutional Source Beutler Lab
Gene Symbol Acss1
Ensembl Gene ENSMUSG00000027452
Gene Nameacyl-CoA synthetase short-chain family member 1
SynonymsAcas2l, Acas2, 1110032O15Rik, AceCS2
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location150618105-150668500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150659903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 115 (S115P)
Ref Sequence ENSEMBL: ENSMUSP00000028944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028944
AA Change: S115P

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028944
Gene: ENSMUSG00000027452
AA Change: S115P

DomainStartEndE-ValueType
low complexity region 4 29 N/A INTRINSIC
Pfam:ACAS_N 51 107 8.6e-17 PFAM
Pfam:AMP-binding 108 549 2.5e-90 PFAM
Pfam:AMP-binding_C 557 635 7.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141785
Meta Mutation Damage Score 0.2074 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial acetyl-CoA synthetase enzyme. A similar protein in mice plays an important role in the tricarboxylic acid cycle by catalyzing the conversion of acetate to acetyl CoA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice with disruptions in this gene display abnormalities in acetate metabolism. Ability to maintain body temperature under fasting conditions is reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Acss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Acss1 APN 2 150619686 missense probably benign 0.27
IGL01594:Acss1 APN 2 150621530 missense probably damaging 0.98
IGL01781:Acss1 APN 2 150637872 missense probably damaging 1.00
IGL02189:Acss1 APN 2 150629868 missense probably damaging 0.98
IGL02735:Acss1 APN 2 150638467 missense probably damaging 1.00
IGL02738:Acss1 APN 2 150624872 splice site probably benign
IGL03399:Acss1 APN 2 150637878 missense probably damaging 1.00
Cutlass UTSW 2 150668131 nonsense probably null
scimitar UTSW 2 150628492 critical splice donor site probably null
R0058:Acss1 UTSW 2 150628539 missense probably damaging 0.97
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R0063:Acss1 UTSW 2 150627292 missense probably damaging 1.00
R1550:Acss1 UTSW 2 150642795 missense probably damaging 0.99
R1651:Acss1 UTSW 2 150638437 missense possibly damaging 0.94
R2066:Acss1 UTSW 2 150668131 nonsense probably null
R4559:Acss1 UTSW 2 150638485 missense probably benign 0.19
R4893:Acss1 UTSW 2 150629866 missense probably damaging 0.97
R6408:Acss1 UTSW 2 150628492 critical splice donor site probably null
R6459:Acss1 UTSW 2 150667920 missense probably damaging 0.97
R7593:Acss1 UTSW 2 150619768 nonsense probably null
R7598:Acss1 UTSW 2 150638450 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTAGGCGTCACCAAGCAAAC -3'
(R):5'- TGGAAGGTCACCTTGTAGGC -3'

Sequencing Primer
(F):5'- GTCCTTCCAGACTAGAAAGTGTG -3'
(R):5'- AAGGTCACCTTGTAGGCAGGTC -3'
Posted On2015-07-07