Incidental Mutation 'R4414:Iqgap3'
ID328052
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88096986 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 460 (V460F)
Ref Sequence ENSEMBL: ENSMUSP00000142013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000195465]
Predicted Effect probably benign
Transcript: ENSMUST00000071812
AA Change: V460F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: V460F

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195465
AA Change: V460F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068
AA Change: V460F

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
Booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2352:Iqgap3 UTSW 3 88104508 missense possibly damaging 0.94
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
R7170:Iqgap3 UTSW 3 88102063 missense probably damaging 1.00
R7288:Iqgap3 UTSW 3 88108835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTGAATGAAGCCCCTGG -3'
(R):5'- ATCCAGTTATAAGTCCTGCATATGC -3'

Sequencing Primer
(F):5'- TGGCCCTTGGGAATGGAAC -3'
(R):5'- GTAGGCACTCAAACATTTGCTCTG -3'
Posted On2015-07-07