Mutagenetix > Incidental Mutation

Incidental Mutation 'R4414:Mmrn1'

328061

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

041694-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4414 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60944586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 9 (L9P)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000129603
AA Change: L9P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: L9P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145763

Predicted Effect

probably damaging
Transcript: ENSMUST00000204333
AA Change: L9P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: L9P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Meta Mutation Damage Score

0.2772

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	C	4: 41,505,574	T183A	possibly damaging	Het
4930503E14Rik	T	A	14: 44,169,233	M120L	probably benign	Het
Aco2	A	G	15: 81,889,383		probably null	Het
Acss1	A	G	2: 150,659,903	S115P	possibly damaging	Het
Ank2	A	T	3: 127,225,762		probably null	Het
AU041133	C	T	10: 82,151,482	T323M	probably damaging	Het
Bdp1	T	C	13: 100,030,861	D2215G	probably damaging	Het
Bod1l	G	A	5: 41,820,527	T1148I	probably benign	Het
Celsr1	C	T	15: 85,963,133	V1468I	probably benign	Het
Celsr1	A	G	15: 85,927,999	V2065A	probably damaging	Het
Cep89	A	G	7: 35,416,397		probably benign	Het
Cfap58	A	G	19: 47,953,041	K283E	possibly damaging	Het
Cog5	C	T	12: 31,660,854	Q78*	probably null	Het
Col20a1	C	T	2: 181,001,250	R796C	possibly damaging	Het
Dnah7b	A	T	1: 46,126,680	T502S	probably benign	Het
Dnm1l	A	G	16: 16,342,695		probably null	Het
Dse	A	T	10: 34,152,636	F819L	probably benign	Het
Eloa	G	T	4: 136,011,242	L136I	possibly damaging	Het
Eloa	T	A	4: 136,011,265	H128L	probably benign	Het
Fbxl6	T	C	15: 76,537,724	E205G	possibly damaging	Het
Golim4	T	G	3: 75,895,040	N287T	probably benign	Het
Gpx8	T	A	13: 113,043,148	K206N	possibly damaging	Het
Iqgap3	G	T	3: 88,096,986	V460F	probably benign	Het
Kcne4	A	T	1: 78,817,934	M100L	probably benign	Het
Kmt2a	A	T	9: 44,809,780		probably benign	Het
Ktn1	G	A	14: 47,724,930	W1117*	probably null	Het
Lad1	A	G	1: 135,828,746	D364G	probably benign	Het
Lmln	T	G	16: 33,109,850	I559S	probably benign	Het
Mapk4	A	T	18: 73,930,538	F538I	possibly damaging	Het
Mlxipl	A	G	5: 135,137,399		probably benign	Het
Mnat1	G	A	12: 73,181,827	R155H	probably damaging	Het
Mtmr11	T	C	3: 96,167,891		probably benign	Het
Naaladl1	T	C	19: 6,115,551	L745P	probably damaging	Het
Obsl1	A	T	1: 75,490,902	D1409E	probably benign	Het
Oit3	T	C	10: 59,428,103	Y403C	probably damaging	Het
Pla2g4e	A	T	2: 120,182,713	H375Q	probably benign	Het
Prodh2	G	A	7: 30,506,452	V238M	probably damaging	Het
Rdh14	G	A	12: 10,391,231		probably null	Het
Rho	G	A	6: 115,935,230	V76I	probably benign	Het
Rock1	A	T	18: 10,080,514	M1010K	probably damaging	Het
Ros1	A	G	10: 52,162,704		probably null	Het
Sim1	A	T	10: 50,981,612	D486V	probably benign	Het
Src	A	G	2: 157,464,653	D192G	probably damaging	Het
Stox1	T	C	10: 62,659,569	N975S	probably benign	Het
Tmem145	A	G	7: 25,307,129	Y54C	probably damaging	Het
Try4	C	T	6: 41,304,971	P164S	possibly damaging	Het
Vegfc	A	T	8: 54,181,095	N270Y	probably benign	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TTCCTGAGTGCACTGCAAAC -3'
(R):5'- TGACTGTAGGAGAACATCGTCTTC -3'

Sequencing Primer
(F):5'- TGCAAACACAGAAACCTGTTTC -3'
(R):5'- TTCAGAAGATCTCTCAGCAGCTG -3'

Posted On

2015-07-07