Incidental Mutation 'R4414:Mapk4'
ID328084
Institutional Source Beutler Lab
Gene Symbol Mapk4
Ensembl Gene ENSMUSG00000024558
Gene Namemitogen-activated protein kinase 4
SynonymsErk3-related, p63Mapk
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4414 (G1)
Quality Score221
Status Validated
Chromosome18
Chromosomal Location73928486-74065359 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73930538 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 538 (F538I)
Ref Sequence ENSEMBL: ENSMUSP00000089462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091851] [ENSMUST00000159162] [ENSMUST00000162863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091851
AA Change: F538I

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000089462
Gene: ENSMUSG00000024558
AA Change: F538I

DomainStartEndE-ValueType
S_TKc 20 312 3.81e-79 SMART
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159162
SMART Domains Protein: ENSMUSP00000123922
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 232 2.3e-58 PFAM
Pfam:Pkinase_Tyr 22 232 5.5e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162863
SMART Domains Protein: ENSMUSP00000124408
Gene: ENSMUSG00000024558

DomainStartEndE-ValueType
Pfam:Pkinase 20 192 1.7e-41 PFAM
Pfam:Pkinase_Tyr 22 189 5.9e-25 PFAM
Meta Mutation Damage Score 0.2282 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitogen-activated protein kinase 4 is a member of the mitogen-activated protein kinase family. Tyrosine kinase growth factor receptors activate mitogen-activated protein kinases which then translocate into the nucleus and phosphorylate nuclear targets. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viabel and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Mapk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02396:Mapk4 APN 18 73933997 intron probably null
IGL02621:Mapk4 APN 18 73970275 missense probably damaging 1.00
IGL03068:Mapk4 APN 18 73970344 missense probably damaging 1.00
R0041:Mapk4 UTSW 18 73935038 missense probably damaging 1.00
R0519:Mapk4 UTSW 18 73970321 missense probably damaging 1.00
R0636:Mapk4 UTSW 18 73930454 missense probably benign
R0918:Mapk4 UTSW 18 73970337 missense probably damaging 1.00
R1654:Mapk4 UTSW 18 73930939 missense probably damaging 1.00
R2913:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R2914:Mapk4 UTSW 18 73935165 missense probably benign 0.34
R4089:Mapk4 UTSW 18 73930459 missense probably damaging 1.00
R4487:Mapk4 UTSW 18 73930975 missense probably damaging 1.00
R4792:Mapk4 UTSW 18 73937250 missense probably damaging 0.98
R5445:Mapk4 UTSW 18 73931002 missense probably benign 0.00
R5597:Mapk4 UTSW 18 73937270 missense probably benign 0.12
R5654:Mapk4 UTSW 18 73970294 missense probably damaging 1.00
R6700:Mapk4 UTSW 18 73930811 missense probably damaging 1.00
R6793:Mapk4 UTSW 18 73930468 missense probably damaging 1.00
R7200:Mapk4 UTSW 18 73930919 missense possibly damaging 0.92
R7335:Mapk4 UTSW 18 73937267 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTCTGCTAACCCCAACGCAG -3'
(R):5'- AGCAAGCCTCTTTCTGGAG -3'

Sequencing Primer
(F):5'- CAGCTTTCTGGATGGGGATCC -3'
(R):5'- AGCCTCTTTCTGGAGATTGCACAG -3'
Posted On2015-07-07