Incidental Mutation 'R4414:Cfap58'
ID328086
Institutional Source Beutler Lab
Gene Symbol Cfap58
Ensembl Gene ENSMUSG00000046585
Gene Namecilia and flagella associated protein 58
SynonymsLOC381229, Ccdc147
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47937712-48035379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47953041 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 283 (K283E)
Ref Sequence ENSEMBL: ENSMUSP00000070533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066308]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066308
AA Change: K283E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: K283E

DomainStartEndE-ValueType
coiled coil region 106 579 N/A INTRINSIC
coiled coil region 642 706 N/A INTRINSIC
low complexity region 740 762 N/A INTRINSIC
coiled coil region 772 832 N/A INTRINSIC
Meta Mutation Damage Score 0.3803 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Cfap58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cfap58 APN 19 47974567 missense probably benign 0.30
IGL02068:Cfap58 APN 19 47986512 missense probably damaging 1.00
IGL02609:Cfap58 APN 19 47975502 missense possibly damaging 0.80
IGL03376:Cfap58 APN 19 48034725 missense possibly damaging 0.60
PIT4515001:Cfap58 UTSW 19 48034683 missense probably benign
PIT4618001:Cfap58 UTSW 19 47975514 missense probably damaging 1.00
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0454:Cfap58 UTSW 19 47974680 critical splice donor site probably null
R0545:Cfap58 UTSW 19 47941097 splice site probably benign
R0789:Cfap58 UTSW 19 47955309 missense probably benign 0.09
R0926:Cfap58 UTSW 19 47962562 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1493:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1541:Cfap58 UTSW 19 47983530 missense probably damaging 1.00
R1629:Cfap58 UTSW 19 47941339 missense probably benign 0.02
R1648:Cfap58 UTSW 19 47955405 missense probably benign 0.13
R1837:Cfap58 UTSW 19 48029139 missense probably damaging 0.98
R2307:Cfap58 UTSW 19 47962486 nonsense probably null
R2513:Cfap58 UTSW 19 47962542 missense probably benign 0.03
R3802:Cfap58 UTSW 19 47953059 missense possibly damaging 0.81
R4233:Cfap58 UTSW 19 47975555 missense possibly damaging 0.60
R4258:Cfap58 UTSW 19 47949484 splice site probably null
R4763:Cfap58 UTSW 19 47983506 missense probably damaging 1.00
R5300:Cfap58 UTSW 19 47941156 missense probably benign 0.09
R5406:Cfap58 UTSW 19 48029102 missense possibly damaging 0.81
R5497:Cfap58 UTSW 19 48029109 missense probably benign 0.08
R5635:Cfap58 UTSW 19 47983542 missense possibly damaging 0.47
R6315:Cfap58 UTSW 19 47941277 missense probably benign 0.40
R6483:Cfap58 UTSW 19 47983452 missense probably benign 0.00
R6727:Cfap58 UTSW 19 47955417 missense probably benign 0.30
R6896:Cfap58 UTSW 19 47944187 missense probably damaging 0.98
R7461:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7473:Cfap58 UTSW 19 47974625 nonsense probably null
R7613:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7650:Cfap58 UTSW 19 47986528 missense possibly damaging 0.84
R7982:Cfap58 UTSW 19 47974567 missense probably benign 0.30
R8083:Cfap58 UTSW 19 47983518 missense probably damaging 1.00
R8121:Cfap58 UTSW 19 48029104 missense probably benign 0.40
R8321:Cfap58 UTSW 19 47958147 missense probably damaging 0.99
R8396:Cfap58 UTSW 19 48029101 missense probably damaging 1.00
R8462:Cfap58 UTSW 19 47983650 missense possibly damaging 0.94
R8745:Cfap58 UTSW 19 47941114 nonsense probably null
R8805:Cfap58 UTSW 19 47953096 missense not run
X0067:Cfap58 UTSW 19 47955308 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTGTAAGAGGAAAGGGCC -3'
(R):5'- TCCAGGCCTGAAGTGATCATC -3'

Sequencing Primer
(F):5'- CCGTGGCTGGTGTCTTCTCAG -3'
(R):5'- CCTCGCTCCGGCTAATGTAAG -3'
Posted On2015-07-07