Mutagenetix > Incidental Mutations

Incidental Mutation 'R4425:Efl1'

328104

Institutional Source

Beutler Lab

Gene Symbol

Efl1

Ensembl Gene

ENSMUSG00000038563

Gene Name

elongation factor like GPTase 1

Synonyms

6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1

MMRRC Submission

041144-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R4425 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82648614-82777852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 82763283 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 960 (C960Y)

Ref Sequence

ENSEMBL: ENSMUSP00000137061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039881
AA Change: C960Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: C960Y

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	365	7.4e-62	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:EFG_II	614	687	4.3e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179489
AA Change: C960Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: C960Y

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	364	8.7e-58	PFAM
low complexity region	435	451	N/A	INTRINSIC
Pfam:GTP_EFTU_D2	504	599	1e-7	PFAM
Pfam:EFG_II	614	687	1.8e-9	PFAM
EFG_C	986	1075	1.03e-12	SMART

Meta Mutation Damage Score

0.3560

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	T	C	11: 94,346,044	T1456A	probably damaging	Het
Acad11	T	C	9: 104,073,645	F56S	probably damaging	Het
Adamts8	A	G	9: 30,956,656	N592S	possibly damaging	Het
Amh	A	G	10: 80,806,921	D313G	probably damaging	Het
Ampd2	T	C	3: 108,086,736		probably benign	Het
Arap3	A	G	18: 37,978,600	L1115P	probably damaging	Het
Arfgap1	C	A	2: 180,981,076	D327E	probably benign	Het
Capns2	T	A	8: 92,901,624	I47N	possibly damaging	Het
Cd163	T	C	6: 124,327,903	S1080P	possibly damaging	Het
Ceacam10	A	T	7: 24,781,008	Y68F	possibly damaging	Het
Cep44	G	A	8: 56,538,617	P317S	probably benign	Het
Cfh	A	T	1: 140,100,875	Y688*	probably null	Het
Chrnb1	A	T	11: 69,786,947	S326R	probably damaging	Het
Cngb1	C	T	8: 95,299,716	V25M	probably damaging	Het
Cyp2c50	A	T	19: 40,090,692	N160Y	possibly damaging	Het
Dalrd3	T	C	9: 108,571,601		probably benign	Het
Eef1d	C	A	15: 75,902,799	S253I	possibly damaging	Het
Elmo1	C	G	13: 20,600,212	Y646*	probably null	Het
Epb41l2	C	A	10: 25,506,180	D701E	possibly damaging	Het
Fbxl4	T	A	4: 22,422,699		probably null	Het
Fhod1	T	C	8: 105,337,351		probably benign	Het
Gm21761	C	A	13: 119,912,372	L127F	probably damaging	Het
Gm8741	G	T	17: 35,336,086		noncoding transcript	Het
Igkv10-95	A	T	6: 68,680,622	I21F	probably damaging	Het
Il10rb	C	A	16: 91,407,715	N51K	possibly damaging	Het
Krt78	T	C	15: 101,947,940	T479A	probably benign	Het
Lrig3	T	C	10: 126,013,404	S998P	probably benign	Het
Lrrc8c	T	A	5: 105,607,889	M510K	probably benign	Het
Nfrkb	G	T	9: 31,399,962	C369F	probably damaging	Het
Nphp1	T	C	2: 127,788,799	E19G	possibly damaging	Het
Olfr1307	T	C	2: 111,945,189	H89R	probably benign	Het
Olfr713	A	C	7: 107,036,491	E112A	probably damaging	Het
Ovol3	A	T	7: 30,235,364		probably null	Het
Ppp1r16b	C	T	2: 158,757,254	T382I	probably benign	Het
Rims2	T	C	15: 39,437,924		probably null	Het
Sh3rf3	T	C	10: 59,083,576	V505A	probably benign	Het
Shkbp1	T	C	7: 27,343,302	N570S	probably benign	Het
Slc35f4	C	T	14: 49,318,850	V149I	possibly damaging	Het
Snx27	A	G	3: 94,562,023	F4L	probably benign	Het
Syvn1	C	T	19: 6,049,921		probably benign	Het
Tagap1	G	A	17: 6,956,112	S395L	probably benign	Het
Tek	A	G	4: 94,863,667	T1014A	probably damaging	Het
Top2a	A	G	11: 99,001,405	I1077T	probably benign	Het
Tpo	T	C	12: 30,104,016	Y230C	probably damaging	Het
Trav12-2	A	G	14: 53,616,875	Q102R	possibly damaging	Het
Ttn	G	A	2: 76,903,086		probably benign	Het
Vmn1r183	A	T	7: 24,055,548	I259F	probably benign	Het
Vmn1r228	T	C	17: 20,776,599	E219G	probably damaging	Het
Vsig8	G	T	1: 172,563,147	G254V	probably damaging	Het
Vwa8	A	G	14: 79,082,806	I1086V	probably benign	Het
Zfp423	G	A	8: 87,782,973	H123Y	probably damaging	Het
Zfp811	A	T	17: 32,797,547	C506*	probably null	Het

Other mutations in Efl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00541:Efl1	APN	7	82658111	missense	probably damaging	1.00
IGL00696:Efl1	APN	7	82651872	splice site	probably benign
IGL01344:Efl1	APN	7	82681480	splice site	probably benign
IGL01871:Efl1	APN	7	82763319	missense	possibly damaging	0.64
IGL01941:Efl1	APN	7	82697976	missense	probably benign	0.17
IGL02104:Efl1	APN	7	82658055	critical splice acceptor site	probably null
IGL02150:Efl1	APN	7	82686691	missense	probably benign
IGL02484:Efl1	APN	7	82683039	missense	probably damaging	0.98
IGL03140:Efl1	APN	7	82692881	missense	probably benign	0.00
IGL03188:Efl1	APN	7	82671701	missense	probably damaging	1.00
IGL03014:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
PIT4469001:Efl1	UTSW	7	82658165	missense	probably benign	0.14
R0148:Efl1	UTSW	7	82671670	missense	probably damaging	1.00
R0226:Efl1	UTSW	7	82693011	splice site	probably benign
R0638:Efl1	UTSW	7	82651887	missense	probably damaging	1.00
R0684:Efl1	UTSW	7	82651886	missense	probably damaging	1.00
R1018:Efl1	UTSW	7	82763013	missense	possibly damaging	0.94
R1290:Efl1	UTSW	7	82671728	missense	probably damaging	1.00
R1720:Efl1	UTSW	7	82683721	missense	possibly damaging	0.50
R1933:Efl1	UTSW	7	82763117	nonsense	probably null
R1973:Efl1	UTSW	7	82762877	missense	probably damaging	1.00
R2016:Efl1	UTSW	7	82753709	missense	probably damaging	1.00
R2124:Efl1	UTSW	7	82692913	missense	probably damaging	1.00
R2290:Efl1	UTSW	7	82777670	missense	probably damaging	1.00
R2415:Efl1	UTSW	7	82697967	missense	probably damaging	1.00
R3545:Efl1	UTSW	7	82762810	missense	probably benign	0.00
R3688:Efl1	UTSW	7	82762970	missense	probably benign	0.00
R4092:Efl1	UTSW	7	82762827	missense	probably benign	0.00
R4207:Efl1	UTSW	7	82750816	missense	probably damaging	0.98
R4347:Efl1	UTSW	7	82697966	missense	probably damaging	1.00
R4816:Efl1	UTSW	7	82671719	missense	probably damaging	1.00
R4858:Efl1	UTSW	7	82671627	missense	probably damaging	1.00
R5077:Efl1	UTSW	7	82658087	missense	probably damaging	1.00
R5185:Efl1	UTSW	7	82772499	missense	probably damaging	1.00
R5319:Efl1	UTSW	7	82674506	missense	probably damaging	1.00
R5771:Efl1	UTSW	7	82692524	missense	probably benign	0.26
R5857:Efl1	UTSW	7	82763189	missense	probably benign
R5956:Efl1	UTSW	7	82651899	missense	probably damaging	1.00
R6433:Efl1	UTSW	7	82674568	missense	probably damaging	1.00
R7131:Efl1	UTSW	7	82658064	missense	probably damaging	1.00
R7143:Efl1	UTSW	7	82762680	missense	probably damaging	1.00
R7312:Efl1	UTSW	7	82681444	missense	probably benign	0.10
R7409:Efl1	UTSW	7	82697913	missense	probably damaging	0.98
R7422:Efl1	UTSW	7	82681379	missense	probably damaging	1.00
R7453:Efl1	UTSW	7	82681467	missense	possibly damaging	0.76
R7504:Efl1	UTSW	7	82683049	missense	probably damaging	1.00
R7884:Efl1	UTSW	7	82658099	missense	probably damaging	1.00
R7969:Efl1	UTSW	7	82692970	missense	probably benign	0.03
R8394:Efl1	UTSW	7	82762778	missense	probably benign	0.00
R8702:Efl1	UTSW	7	82750790	critical splice acceptor site	probably null
R8924:Efl1	UTSW	7	82762953	missense	probably benign	0.03
Z1088:Efl1	UTSW	7	82692850	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATTGTGAGTGGCTTCCAGC -3'
(R):5'- AGGAGACCTTGTTGCTCAGG -3'

Sequencing Primer
(F):5'- TCTCTGGCCCCATGTGTGAG -3'
(R):5'- GGCACCTCTCTGTCTTCATC -3'

Posted On

2015-07-07