Incidental Mutation 'R4425:Cep44'
ID328106
Institutional Source Beutler Lab
Gene Symbol Cep44
Ensembl Gene ENSMUSG00000038215
Gene Namecentrosomal protein 44
Synonyms4933440G23Rik, BC088983
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R4425 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location56531522-56551047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56538617 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 317 (P317S)
Ref Sequence ENSEMBL: ENSMUSP00000042586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040330] [ENSMUST00000140107]
Predicted Effect probably benign
Transcript: ENSMUST00000040330
AA Change: P317S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042586
Gene: ENSMUSG00000038215
AA Change: P317S

DomainStartEndE-ValueType
Pfam:CEP44 5 131 2.5e-52 PFAM
coiled coil region 232 263 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123493
AA Change: P258S
SMART Domains Protein: ENSMUSP00000116884
Gene: ENSMUSG00000038215
AA Change: P258S

DomainStartEndE-ValueType
Pfam:CEP44 1 73 3.3e-31 PFAM
coiled coil region 173 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140107
SMART Domains Protein: ENSMUSP00000114502
Gene: ENSMUSG00000038215

DomainStartEndE-ValueType
Pfam:CEP44 5 136 1.7e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211049
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Cep44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Cep44 APN 8 56547400 missense probably damaging 1.00
IGL02932:Cep44 APN 8 56547424 missense probably damaging 1.00
R0347:Cep44 UTSW 8 56545475 missense probably damaging 1.00
R0609:Cep44 UTSW 8 56544152 missense possibly damaging 0.79
R0669:Cep44 UTSW 8 56540973 missense possibly damaging 0.74
R1449:Cep44 UTSW 8 56540950 missense probably benign 0.01
R1493:Cep44 UTSW 8 56532835 missense probably damaging 1.00
R4114:Cep44 UTSW 8 56545422 missense probably benign 0.25
R4422:Cep44 UTSW 8 56538617 missense probably benign 0.00
R4423:Cep44 UTSW 8 56538617 missense probably benign 0.00
R4621:Cep44 UTSW 8 56542916 missense probably damaging 0.99
R5017:Cep44 UTSW 8 56544207 missense possibly damaging 0.86
R5190:Cep44 UTSW 8 56532796 missense probably benign 0.05
R5898:Cep44 UTSW 8 56541021 missense probably damaging 1.00
R5938:Cep44 UTSW 8 56547422 missense possibly damaging 0.93
R6080:Cep44 UTSW 8 56539841 missense possibly damaging 0.50
R6150:Cep44 UTSW 8 56539805 missense probably benign 0.39
R7016:Cep44 UTSW 8 56544199 missense possibly damaging 0.89
R7141:Cep44 UTSW 8 56539851 missense probably damaging 1.00
R7466:Cep44 UTSW 8 56540983 frame shift probably null
R7753:Cep44 UTSW 8 56532807 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGTGATAAAAGCTGGAGATATGGCTC -3'
(R):5'- CAGGAATGTTACTATCTGCTTCTAC -3'

Sequencing Primer
(F):5'- TGGATCTCTGGATTACACAGGCAC -3'
(R):5'- ATCTGCTTCTACATCTAAATGGTTG -3'
Posted On2015-07-07