Incidental Mutation 'R4425:Adamts8'
ID328111
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4425 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30956656 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 592 (N592S)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068135
AA Change: N592S

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: N592S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214688
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,346,044 T1456A probably damaging Het
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4165:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGACTGAAACCTGCTTCCC -3'
(R):5'- TGTCTCTCAACAGCTCAGAAGAC -3'

Sequencing Primer
(F):5'- GACTGAAACCTGCTTCCCTTTGG -3'
(R):5'- GGAATCTCTTCCTTTGATATCACCG -3'
Posted On2015-07-07