Incidental Mutation 'R4425:Abcc3'
ID328120
Institutional Source Beutler Lab
Gene Symbol Abcc3
Ensembl Gene ENSMUSG00000020865
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 3
SynonymsMRP3, 1700019L09Rik
MMRRC Submission 041144-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4425 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location94343295-94392997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94346044 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1456 (T1456A)
Ref Sequence ENSEMBL: ENSMUSP00000136343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021231] [ENSMUST00000107818] [ENSMUST00000178136]
Predicted Effect probably damaging
Transcript: ENSMUST00000021231
AA Change: T1455A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021231
Gene: ENSMUSG00000020865
AA Change: T1455A

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.4e-43 PFAM
AAA 652 827 2.77e-10 SMART
Pfam:ABC_membrane 963 1235 3.2e-46 PFAM
AAA 1310 1495 2.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107818
SMART Domains Protein: ENSMUSP00000103448
Gene: ENSMUSG00000020864

DomainStartEndE-ValueType
ANK 9 38 7.29e2 SMART
ANK 43 72 3.57e-6 SMART
low complexity region 144 168 N/A INTRINSIC
low complexity region 234 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140985
Predicted Effect probably damaging
Transcript: ENSMUST00000178136
AA Change: T1456A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136343
Gene: ENSMUSG00000020865
AA Change: T1456A

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 64 86 N/A INTRINSIC
transmembrane domain 101 123 N/A INTRINSIC
transmembrane domain 130 152 N/A INTRINSIC
transmembrane domain 172 190 N/A INTRINSIC
Pfam:ABC_membrane 310 581 4.8e-34 PFAM
AAA 652 827 2.77e-10 SMART
coiled coil region 854 883 N/A INTRINSIC
Pfam:ABC_membrane 967 1236 8.6e-48 PFAM
AAA 1311 1496 2.66e-12 SMART
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit increased liver bile acid levels after bile duct ligation [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T C 9: 104,073,645 F56S probably damaging Het
Adamts8 A G 9: 30,956,656 N592S possibly damaging Het
Amh A G 10: 80,806,921 D313G probably damaging Het
Ampd2 T C 3: 108,086,736 probably benign Het
Arap3 A G 18: 37,978,600 L1115P probably damaging Het
Arfgap1 C A 2: 180,981,076 D327E probably benign Het
Capns2 T A 8: 92,901,624 I47N possibly damaging Het
Cd163 T C 6: 124,327,903 S1080P possibly damaging Het
Ceacam10 A T 7: 24,781,008 Y68F possibly damaging Het
Cep44 G A 8: 56,538,617 P317S probably benign Het
Cfh A T 1: 140,100,875 Y688* probably null Het
Chrnb1 A T 11: 69,786,947 S326R probably damaging Het
Cngb1 C T 8: 95,299,716 V25M probably damaging Het
Cyp2c50 A T 19: 40,090,692 N160Y possibly damaging Het
Dalrd3 T C 9: 108,571,601 probably benign Het
Eef1d C A 15: 75,902,799 S253I possibly damaging Het
Efl1 G A 7: 82,763,283 C960Y probably damaging Het
Elmo1 C G 13: 20,600,212 Y646* probably null Het
Epb41l2 C A 10: 25,506,180 D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 probably null Het
Fhod1 T C 8: 105,337,351 probably benign Het
Gm21761 C A 13: 119,912,372 L127F probably damaging Het
Gm8741 G T 17: 35,336,086 noncoding transcript Het
Igkv10-95 A T 6: 68,680,622 I21F probably damaging Het
Il10rb C A 16: 91,407,715 N51K possibly damaging Het
Krt78 T C 15: 101,947,940 T479A probably benign Het
Lrig3 T C 10: 126,013,404 S998P probably benign Het
Lrrc8c T A 5: 105,607,889 M510K probably benign Het
Nfrkb G T 9: 31,399,962 C369F probably damaging Het
Nphp1 T C 2: 127,788,799 E19G possibly damaging Het
Olfr1307 T C 2: 111,945,189 H89R probably benign Het
Olfr713 A C 7: 107,036,491 E112A probably damaging Het
Ovol3 A T 7: 30,235,364 probably null Het
Ppp1r16b C T 2: 158,757,254 T382I probably benign Het
Rims2 T C 15: 39,437,924 probably null Het
Sh3rf3 T C 10: 59,083,576 V505A probably benign Het
Shkbp1 T C 7: 27,343,302 N570S probably benign Het
Slc35f4 C T 14: 49,318,850 V149I possibly damaging Het
Snx27 A G 3: 94,562,023 F4L probably benign Het
Syvn1 C T 19: 6,049,921 probably benign Het
Tagap1 G A 17: 6,956,112 S395L probably benign Het
Tek A G 4: 94,863,667 T1014A probably damaging Het
Top2a A G 11: 99,001,405 I1077T probably benign Het
Tpo T C 12: 30,104,016 Y230C probably damaging Het
Trav12-2 A G 14: 53,616,875 Q102R possibly damaging Het
Ttn G A 2: 76,903,086 probably benign Het
Vmn1r183 A T 7: 24,055,548 I259F probably benign Het
Vmn1r228 T C 17: 20,776,599 E219G probably damaging Het
Vsig8 G T 1: 172,563,147 G254V probably damaging Het
Vwa8 A G 14: 79,082,806 I1086V probably benign Het
Zfp423 G A 8: 87,782,973 H123Y probably damaging Het
Zfp811 A T 17: 32,797,547 C506* probably null Het
Other mutations in Abcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Abcc3 APN 11 94343785 splice site probably benign
IGL01154:Abcc3 APN 11 94359232 splice site probably benign
IGL01353:Abcc3 APN 11 94352108 missense possibly damaging 0.88
IGL02553:Abcc3 APN 11 94351924 missense probably damaging 1.00
IGL02795:Abcc3 APN 11 94361642 splice site probably benign
IGL02928:Abcc3 APN 11 94361306 missense possibly damaging 0.49
IGL02964:Abcc3 APN 11 94351810 missense possibly damaging 0.93
IGL03006:Abcc3 APN 11 94368595 missense probably benign 0.18
IGL03345:Abcc3 APN 11 94359337 missense probably damaging 1.00
R0200:Abcc3 UTSW 11 94355074 missense probably damaging 0.96
R0377:Abcc3 UTSW 11 94375096 missense possibly damaging 0.90
R0812:Abcc3 UTSW 11 94375202 splice site probably benign
R1269:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1270:Abcc3 UTSW 11 94357384 missense probably damaging 1.00
R1375:Abcc3 UTSW 11 94352216 missense possibly damaging 0.46
R1506:Abcc3 UTSW 11 94357318 missense possibly damaging 0.89
R1525:Abcc3 UTSW 11 94361236 missense probably benign 0.00
R1842:Abcc3 UTSW 11 94359612 missense probably benign 0.00
R1868:Abcc3 UTSW 11 94364063 missense probably benign 0.06
R2069:Abcc3 UTSW 11 94364417 missense probably damaging 1.00
R2132:Abcc3 UTSW 11 94367600 missense probably benign 0.18
R2257:Abcc3 UTSW 11 94363594 missense probably damaging 1.00
R2395:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R2930:Abcc3 UTSW 11 94361810 missense probably damaging 0.99
R3081:Abcc3 UTSW 11 94356976 missense probably damaging 1.00
R3824:Abcc3 UTSW 11 94368620 critical splice acceptor site probably null
R4385:Abcc3 UTSW 11 94368239 missense probably damaging 0.99
R4464:Abcc3 UTSW 11 94358786 missense probably benign 0.01
R4696:Abcc3 UTSW 11 94350991 missense probably benign 0.01
R4877:Abcc3 UTSW 11 94367595 missense probably damaging 0.98
R5172:Abcc3 UTSW 11 94375608 missense probably damaging 1.00
R5586:Abcc3 UTSW 11 94364421 missense probably damaging 1.00
R5682:Abcc3 UTSW 11 94392897 missense probably benign 0.31
R5719:Abcc3 UTSW 11 94351068 missense probably damaging 1.00
R5816:Abcc3 UTSW 11 94343737 missense probably damaging 0.99
R5919:Abcc3 UTSW 11 94357306 missense possibly damaging 0.90
R6222:Abcc3 UTSW 11 94368605 missense probably benign 0.21
R6264:Abcc3 UTSW 11 94373998 missense probably damaging 0.99
R6526:Abcc3 UTSW 11 94359372 missense probably benign 0.21
R6782:Abcc3 UTSW 11 94358950 missense probably damaging 1.00
R6889:Abcc3 UTSW 11 94375555 missense possibly damaging 0.49
R6953:Abcc3 UTSW 11 94374835 missense probably benign 0.03
R7054:Abcc3 UTSW 11 94365225 missense probably benign 0.01
R7131:Abcc3 UTSW 11 94365031 missense probably damaging 1.00
R7210:Abcc3 UTSW 11 94373941 missense probably benign 0.03
R7283:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7284:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7285:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7287:Abcc3 UTSW 11 94357047 missense probably benign 0.44
R7320:Abcc3 UTSW 11 94367645 missense probably benign 0.33
R7450:Abcc3 UTSW 11 94361695 missense probably damaging 1.00
R7469:Abcc3 UTSW 11 94368188 missense probably damaging 1.00
X0064:Abcc3 UTSW 11 94363498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGATACTTTCAATGGCCCTG -3'
(R):5'- TGGAGAACTGTGGCAGAACC -3'

Sequencing Primer
(F):5'- GCCTCTTCCTGACTCCCAG -3'
(R):5'- TCCCGGGCTGCTGAGAAG -3'
Posted On2015-07-07