Incidental Mutation 'R4425:Slc35f4'
ID 328125
Institutional Source Beutler Lab
Gene Symbol Slc35f4
Ensembl Gene ENSMUSG00000021852
Gene Name solute carrier family 35, member F4
Synonyms 4930550L21Rik
MMRRC Submission 041144-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R4425 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 49535976-49763354 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 49556307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 149 (V149I)
Ref Sequence ENSEMBL: ENSMUSP00000154089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074368] [ENSMUST00000123534] [ENSMUST00000138884] [ENSMUST00000146164]
AlphaFold Q8BZK4
Predicted Effect probably benign
Transcript: ENSMUST00000074368
AA Change: V149I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000073972
Gene: ENSMUSG00000021852
AA Change: V149I

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
Pfam:SLC35F 216 435 7.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123534
AA Change: V149I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122405
Gene: ENSMUSG00000021852
AA Change: V149I

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 160 182 N/A INTRINSIC
transmembrane domain 217 234 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135254
Predicted Effect probably benign
Transcript: ENSMUST00000138884
SMART Domains Protein: ENSMUSP00000119007
Gene: ENSMUSG00000021852

DomainStartEndE-ValueType
Pfam:EmrE 18 143 1e-12 PFAM
Pfam:EamA 57 135 8.4e-9 PFAM
Pfam:DUF914 68 314 4.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146164
AA Change: V149I

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1155 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,236,870 (GRCm39) T1456A probably damaging Het
Acad11 T C 9: 103,950,844 (GRCm39) F56S probably damaging Het
Adamts8 A G 9: 30,867,952 (GRCm39) N592S possibly damaging Het
Amh A G 10: 80,642,755 (GRCm39) D313G probably damaging Het
Ampd2 T C 3: 107,994,052 (GRCm39) probably benign Het
Arap3 A G 18: 38,111,653 (GRCm39) L1115P probably damaging Het
Arfgap1 C A 2: 180,622,869 (GRCm39) D327E probably benign Het
Capns2 T A 8: 93,628,252 (GRCm39) I47N possibly damaging Het
Cd163 T C 6: 124,304,862 (GRCm39) S1080P possibly damaging Het
Ceacam10 A T 7: 24,480,433 (GRCm39) Y68F possibly damaging Het
Cep44 G A 8: 56,991,652 (GRCm39) P317S probably benign Het
Cfh A T 1: 140,028,613 (GRCm39) Y688* probably null Het
Chrnb1 A T 11: 69,677,773 (GRCm39) S326R probably damaging Het
Cngb1 C T 8: 96,026,344 (GRCm39) V25M probably damaging Het
Cyp2c50 A T 19: 40,079,136 (GRCm39) N160Y possibly damaging Het
Dalrd3 T C 9: 108,448,800 (GRCm39) probably benign Het
Eef1d C A 15: 75,774,648 (GRCm39) S253I possibly damaging Het
Efl1 G A 7: 82,412,491 (GRCm39) C960Y probably damaging Het
Elmo1 C G 13: 20,784,382 (GRCm39) Y646* probably null Het
Epb41l2 C A 10: 25,382,078 (GRCm39) D701E possibly damaging Het
Fbxl4 T A 4: 22,422,699 (GRCm39) probably null Het
Fhod1 T C 8: 106,063,983 (GRCm39) probably benign Het
Gm8741 G T 17: 35,555,062 (GRCm39) noncoding transcript Het
Igkv10-95 A T 6: 68,657,606 (GRCm39) I21F probably damaging Het
Il10rb C A 16: 91,204,603 (GRCm39) N51K possibly damaging Het
Krt78 T C 15: 101,856,375 (GRCm39) T479A probably benign Het
Lrig3 T C 10: 125,849,273 (GRCm39) S998P probably benign Het
Lrrc8c T A 5: 105,755,755 (GRCm39) M510K probably benign Het
Nfrkb G T 9: 31,311,258 (GRCm39) C369F probably damaging Het
Nphp1 T C 2: 127,630,719 (GRCm39) E19G possibly damaging Het
Or10a5 A C 7: 106,635,698 (GRCm39) E112A probably damaging Het
Or4f14b T C 2: 111,775,534 (GRCm39) H89R probably benign Het
Ovol3 A T 7: 29,934,789 (GRCm39) probably null Het
Ppp1r16b C T 2: 158,599,174 (GRCm39) T382I probably benign Het
Rims2 T C 15: 39,301,320 (GRCm39) probably null Het
Sh3rf3 T C 10: 58,919,398 (GRCm39) V505A probably benign Het
Shkbp1 T C 7: 27,042,727 (GRCm39) N570S probably benign Het
Snx27 A G 3: 94,469,330 (GRCm39) F4L probably benign Het
Syvn1 C T 19: 6,099,951 (GRCm39) probably benign Het
Tagap1 G A 17: 7,223,511 (GRCm39) S395L probably benign Het
Tcstv2b C A 13: 120,373,908 (GRCm39) L127F probably damaging Het
Tek A G 4: 94,751,904 (GRCm39) T1014A probably damaging Het
Top2a A G 11: 98,892,231 (GRCm39) I1077T probably benign Het
Tpo T C 12: 30,154,015 (GRCm39) Y230C probably damaging Het
Trav12-2 A G 14: 53,854,332 (GRCm39) Q102R possibly damaging Het
Ttn G A 2: 76,733,430 (GRCm39) probably benign Het
Vmn1r183 A T 7: 23,754,973 (GRCm39) I259F probably benign Het
Vmn1r228 T C 17: 20,996,861 (GRCm39) E219G probably damaging Het
Vsig8 G T 1: 172,390,714 (GRCm39) G254V probably damaging Het
Vwa8 A G 14: 79,320,246 (GRCm39) I1086V probably benign Het
Zfp423 G A 8: 88,509,601 (GRCm39) H123Y probably damaging Het
Zfp811 A T 17: 33,016,521 (GRCm39) C506* probably null Het
Other mutations in Slc35f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc35f4 APN 14 49,536,334 (GRCm39) missense probably benign 0.15
IGL01640:Slc35f4 APN 14 49,556,225 (GRCm39) missense probably damaging 0.99
IGL01942:Slc35f4 APN 14 49,762,962 (GRCm39) splice site probably benign
IGL01990:Slc35f4 APN 14 49,541,626 (GRCm39) critical splice donor site probably null
IGL02097:Slc35f4 APN 14 49,543,703 (GRCm39) missense probably damaging 1.00
IGL02803:Slc35f4 APN 14 49,541,714 (GRCm39) missense probably benign 0.00
R0005:Slc35f4 UTSW 14 49,559,943 (GRCm39) splice site probably benign
R0238:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0238:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0239:Slc35f4 UTSW 14 49,541,713 (GRCm39) missense possibly damaging 0.78
R0764:Slc35f4 UTSW 14 49,543,796 (GRCm39) splice site probably benign
R1884:Slc35f4 UTSW 14 49,551,091 (GRCm39) missense probably damaging 1.00
R1916:Slc35f4 UTSW 14 49,541,380 (GRCm39) intron probably benign
R2047:Slc35f4 UTSW 14 49,541,029 (GRCm39) intron probably benign
R2239:Slc35f4 UTSW 14 49,543,660 (GRCm39) critical splice donor site probably null
R2380:Slc35f4 UTSW 14 49,543,660 (GRCm39) critical splice donor site probably null
R4273:Slc35f4 UTSW 14 49,541,758 (GRCm39) missense possibly damaging 0.81
R4420:Slc35f4 UTSW 14 49,551,034 (GRCm39) unclassified probably benign
R5261:Slc35f4 UTSW 14 49,540,946 (GRCm39) intron probably benign
R5398:Slc35f4 UTSW 14 49,536,304 (GRCm39) missense probably damaging 1.00
R5402:Slc35f4 UTSW 14 49,556,331 (GRCm39) missense probably damaging 1.00
R6310:Slc35f4 UTSW 14 49,559,914 (GRCm39) missense probably damaging 1.00
R6596:Slc35f4 UTSW 14 49,763,057 (GRCm39) missense probably damaging 1.00
R6729:Slc35f4 UTSW 14 49,556,417 (GRCm39) missense probably benign 0.16
R6864:Slc35f4 UTSW 14 49,556,310 (GRCm39) missense possibly damaging 0.55
R7427:Slc35f4 UTSW 14 49,536,355 (GRCm39) missense probably damaging 0.99
R7428:Slc35f4 UTSW 14 49,536,355 (GRCm39) missense probably damaging 0.99
R7559:Slc35f4 UTSW 14 49,541,732 (GRCm39) missense probably benign 0.03
R7596:Slc35f4 UTSW 14 49,543,666 (GRCm39) missense probably damaging 1.00
R7722:Slc35f4 UTSW 14 49,543,731 (GRCm39) missense probably benign 0.22
R8263:Slc35f4 UTSW 14 49,551,084 (GRCm39) missense probably damaging 1.00
R8525:Slc35f4 UTSW 14 49,541,681 (GRCm39) missense possibly damaging 0.56
R9198:Slc35f4 UTSW 14 49,556,377 (GRCm39) missense unknown
R9615:Slc35f4 UTSW 14 49,556,306 (GRCm39) missense probably benign 0.00
R9751:Slc35f4 UTSW 14 49,536,291 (GRCm39) missense possibly damaging 0.49
R9772:Slc35f4 UTSW 14 49,551,175 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCTGAGGTAAGGGACAC -3'
(R):5'- GCTGACACATCTGACTGCTC -3'

Sequencing Primer
(F):5'- TAAGGGGGCTCATCCTGCTTC -3'
(R):5'- GACACATCTGACTGCTCCTCCAC -3'
Posted On 2015-07-07