Incidental Mutation 'R4426:Rab3gap2'
ID328142
Institutional Source Beutler Lab
Gene Symbol Rab3gap2
Ensembl Gene ENSMUSG00000039318
Gene NameRAB3 GTPase activating protein subunit 2
Synonyms1110059F07Rik
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location185204117-185286759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 185235342 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 141 (S141N)
Ref Sequence ENSEMBL: ENSMUSP00000141608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069652] [ENSMUST00000194740]
Predicted Effect probably damaging
Transcript: ENSMUST00000069652
AA Change: S141N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066325
Gene: ENSMUSG00000039318
AA Change: S141N

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-167 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 767 1366 3.2e-245 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194740
AA Change: S141N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141608
Gene: ENSMUSG00000039318
AA Change: S141N

DomainStartEndE-ValueType
low complexity region 52 62 N/A INTRINSIC
Pfam:RAB3GAP2_N 73 497 1.3e-157 PFAM
low complexity region 667 686 N/A INTRINSIC
Pfam:RAB3GAP2_C 766 1346 2.5e-233 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the RAB3 protein family, members of which are involved in regulated exocytosis of neurotransmitters and hormones. This protein forms the Rab3 GTPase-activating complex with RAB3GAP1, where it constitutes the regulatory subunit, whereas the latter functions as the catalytic subunit. This gene has the highest level of expression in the brain, consistent with it having a key role in neurodevelopment. Mutations in this gene are associated with Martsolf syndrome.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Plin3 T C 17: 56,286,555 Y53C probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Rab3gap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Rab3gap2 APN 1 185238870 missense probably damaging 1.00
IGL01620:Rab3gap2 APN 1 185204326 missense probably benign
IGL01977:Rab3gap2 APN 1 185267023 nonsense probably null
IGL02183:Rab3gap2 APN 1 185271468 nonsense probably null
IGL02229:Rab3gap2 APN 1 185259383 missense possibly damaging 0.71
IGL02231:Rab3gap2 APN 1 185266898 splice site probably benign
IGL02506:Rab3gap2 APN 1 185252024 splice site probably benign
IGL02618:Rab3gap2 APN 1 185251741 missense possibly damaging 0.79
IGL02643:Rab3gap2 APN 1 185267000 missense possibly damaging 0.69
IGL03239:Rab3gap2 APN 1 185249894 missense probably damaging 1.00
PIT4498001:Rab3gap2 UTSW 1 185281685 missense probably damaging 1.00
R0173:Rab3gap2 UTSW 1 185249907 missense possibly damaging 0.51
R0372:Rab3gap2 UTSW 1 185262694 missense possibly damaging 0.93
R0492:Rab3gap2 UTSW 1 185252392 splice site probably benign
R0510:Rab3gap2 UTSW 1 185260508 splice site probably benign
R0708:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R0711:Rab3gap2 UTSW 1 185249926 missense probably damaging 0.99
R1135:Rab3gap2 UTSW 1 185275943 missense possibly damaging 0.95
R1428:Rab3gap2 UTSW 1 185247904 missense probably damaging 1.00
R1599:Rab3gap2 UTSW 1 185251026 missense probably benign 0.07
R1758:Rab3gap2 UTSW 1 185283884 missense probably benign 0.13
R1903:Rab3gap2 UTSW 1 185221902 missense probably benign
R1929:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R1994:Rab3gap2 UTSW 1 185236024 missense probably damaging 1.00
R2010:Rab3gap2 UTSW 1 185278281 missense possibly damaging 0.57
R2102:Rab3gap2 UTSW 1 185282389 missense probably benign 0.00
R2120:Rab3gap2 UTSW 1 185261367 missense possibly damaging 0.95
R2219:Rab3gap2 UTSW 1 185275916 missense probably damaging 0.99
R2259:Rab3gap2 UTSW 1 185221859 missense probably damaging 1.00
R2270:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R2272:Rab3gap2 UTSW 1 185283542 critical splice donor site probably null
R3083:Rab3gap2 UTSW 1 185204269 missense probably benign 0.00
R3776:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R4050:Rab3gap2 UTSW 1 185272643 critical splice donor site probably null
R4130:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R4176:Rab3gap2 UTSW 1 185246666 missense probably damaging 0.99
R4296:Rab3gap2 UTSW 1 185255837 critical splice donor site probably null
R4416:Rab3gap2 UTSW 1 185282347 missense probably benign 0.00
R4516:Rab3gap2 UTSW 1 185267068 missense probably benign
R4518:Rab3gap2 UTSW 1 185267068 missense probably benign
R4891:Rab3gap2 UTSW 1 185259366 missense probably benign 0.00
R4913:Rab3gap2 UTSW 1 185262829 missense probably benign 0.12
R4955:Rab3gap2 UTSW 1 185267155 intron probably benign
R5411:Rab3gap2 UTSW 1 185277145 critical splice acceptor site probably null
R5516:Rab3gap2 UTSW 1 185235487 missense probably benign 0.02
R5670:Rab3gap2 UTSW 1 185221899 missense probably benign
R5670:Rab3gap2 UTSW 1 185277205 missense probably damaging 1.00
R6380:Rab3gap2 UTSW 1 185235984 missense probably damaging 1.00
R6533:Rab3gap2 UTSW 1 185232954 splice site probably null
R6655:Rab3gap2 UTSW 1 185250011 missense probably damaging 1.00
R6676:Rab3gap2 UTSW 1 185283410 missense probably damaging 1.00
R6726:Rab3gap2 UTSW 1 185247865 missense probably damaging 0.99
R6969:Rab3gap2 UTSW 1 185236012 missense probably damaging 1.00
R7151:Rab3gap2 UTSW 1 185248053 missense probably benign 0.00
R7168:Rab3gap2 UTSW 1 185204297 missense possibly damaging 0.51
R7196:Rab3gap2 UTSW 1 185281667 missense probably damaging 1.00
R7201:Rab3gap2 UTSW 1 185267191 missense probably damaging 1.00
R7371:Rab3gap2 UTSW 1 185251068 missense probably damaging 1.00
Z1088:Rab3gap2 UTSW 1 185281677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGTCACTTTGTACCTACTG -3'
(R):5'- ACCTCAGTGTAGAAGCGCAC -3'

Sequencing Primer
(F):5'- TATGTCATGAATGCCAGGCC -3'
(R):5'- CTCAGTGTAGAAGCGCACATAGC -3'
Posted On2015-07-07