Mutagenetix > Incidental Mutations

Incidental Mutation 'R4426:Cic'

328161

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

041697-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R4426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

utr 3 prime

DNA Base Change (assembly)

C to T at 25294008 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000005583] [ENSMUST00000108410] [ENSMUST00000148150] [ENSMUST00000155118] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

Predicted Effect

probably benign
Transcript: ENSMUST00000005578

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000005583

SMART Domains

Protein: ENSMUSP00000005583
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	12	203	3.8e-13	PFAM
Pfam:Lipase_GDSL	42	209	1.2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108410

SMART Domains

Protein: ENSMUSP00000104048
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	4	151	1.2e-23	PFAM
low complexity region	155	166	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140093

Predicted Effect

probably benign
Transcript: ENSMUST00000148150

SMART Domains

Protein: ENSMUSP00000121250
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	43	143	5.5e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149634

Predicted Effect

probably benign
Transcript: ENSMUST00000155118

SMART Domains

Protein: ENSMUSP00000120379
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	43	149	2.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163320

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163901
AA Change: P106L

SMART Domains

Protein: ENSMUSP00000127858
Gene: ENSMUSG00000005442
AA Change: P106L

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
low complexity region	114	128	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165239

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167162

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

probably benign
Transcript: ENSMUST00000169266

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	G	T	5: 90,572,783	C271F	probably damaging	Het
Arhgef39	C	T	4: 43,497,112	G293E	possibly damaging	Het
Atp8a1	A	C	5: 67,774,828	I206S	probably benign	Het
BC053393	T	A	11: 46,584,420	F147L	probably benign	Het
Cacnb2	A	T	2: 14,975,215	R290*	probably null	Het
Ccdc137	T	C	11: 120,460,248	S159P	probably damaging	Het
Chil5	A	G	3: 106,019,627	S231P	probably damaging	Het
Csmd3	A	G	15: 47,669,185	V2434A	possibly damaging	Het
Csnk1a1	A	G	18: 61,585,310		probably benign	Het
D330045A20Rik	T	C	X: 139,480,896	V134A	possibly damaging	Het
Eif4e1b	T	C	13: 54,784,483	S49P	probably benign	Het
Far1	C	A	7: 113,550,001	P194Q	probably benign	Het
Fut4	T	C	9: 14,751,381	T206A	possibly damaging	Het
Galnt7	G	T	8: 57,552,572	S209*	probably null	Het
Gas2l1	A	G	11: 5,063,908	V184A	probably benign	Het
Herc1	T	C	9: 66,496,005	L4402P	probably damaging	Het
Hoxa13	C	A	6: 52,260,729		probably benign	Het
Ighv1-9	T	A	12: 114,583,796	K42*	probably null	Het
Kif20a	C	T	18: 34,631,941	R743W	probably damaging	Het
Lama2	G	A	10: 27,422,558	R181C	probably damaging	Het
Lrp2	G	T	2: 69,506,348	T1360K	probably benign	Het
Map4k1	G	A	7: 28,988,595	V177I	probably damaging	Het
Nbea	G	A	3: 56,082,379	T352I	probably damaging	Het
Nde1	A	G	16: 14,188,336	T82A	possibly damaging	Het
Nes	A	G	3: 87,976,042	E536G	probably damaging	Het
Nms	C	T	1: 38,939,296	P4L	probably benign	Het
Nrip1	T	C	16: 76,291,405	Q1088R	possibly damaging	Het
Nwd1	A	G	8: 72,666,795	K229E	probably damaging	Het
Olfr583	T	C	7: 103,051,811	L171P	probably damaging	Het
Olfr600	A	G	7: 103,346,083	Y282H	probably damaging	Het
Pcdhac2	T	A	18: 37,144,743	S259T	probably benign	Het
Pdcd5	T	C	7: 35,646,180	D102G	possibly damaging	Het
Pgm2	T	C	4: 99,962,140	V169A	probably benign	Het
Pitpnm2	C	T	5: 124,142,123	E121K	probably benign	Het
Plin3	T	C	17: 56,286,555	Y53C	probably damaging	Het
Poc1b	T	C	10: 99,155,139		probably null	Het
Polr2c	A	T	8: 94,863,462	N232Y	probably damaging	Het
Ppp1r9b	A	T	11: 95,001,324	R188S	possibly damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rab3gap2	G	A	1: 185,235,342	S141N	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rnf166	A	G	8: 122,470,240	L91P	probably damaging	Het
Robo2	T	A	16: 73,948,266	M200L	probably damaging	Het
Rp1	A	T	1: 4,347,924	H988Q	probably benign	Het
Sbno2	T	C	10: 80,072,358	K69R	probably null	Het
Sgce	G	A	6: 4,691,459	A295V	probably damaging	Het
Shc3	C	G	13: 51,480,094		probably null	Het
Slc44a1	T	C	4: 53,563,286	V671A	probably benign	Het
Sptbn4	A	C	7: 27,423,798	L233R	probably damaging	Het
Stx5a	A	G	19: 8,749,740	T252A	probably benign	Het
Tmem87b	C	T	2: 128,846,750	A485V	probably benign	Het
Tns1	A	G	1: 73,985,749	I403T	probably damaging	Het
Ttll10	G	C	4: 156,048,561	T22R	possibly damaging	Het
Uevld	A	T	7: 46,940,142	S293T	probably benign	Het
Utp18	T	C	11: 93,866,438	N467D	probably damaging	Het
Vmn1r39	A	T	6: 66,805,361		probably null	Het
Vmn2r106	A	G	17: 20,285,379	S18P	probably benign	Het
Vmn2r61	A	T	7: 42,300,733	H859L	probably benign	Het
Vmn2r61	T	C	7: 42,300,735	S860P	probably benign	Het
Vmn2r72	G	A	7: 85,737,828	R843*	probably null	Het
Vwc2	A	G	11: 11,154,235	T256A	probably damaging	Het
Zfp715	T	C	7: 43,311,092	D25G	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4664:Cic	UTSW	7	25290674	small deletion	probably benign
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
V7732:Cic	UTSW	7	25292245	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATGCAGAATGGCTCCTGTGAG -3'
(R):5'- TCCACCTGGAGCTAGATAGG -3'

Sequencing Primer
(F):5'- TCCTGTGAGGGCTGCAAG -3'
(R):5'- CACCTGGAGCTAGATAGGAGTGTG -3'

Posted On

2015-07-07