Mutagenetix > Incidental Mutations

Incidental Mutation 'R4426:Galnt7'

328172

Institutional Source

Beutler Lab

Gene Symbol

Galnt7

Ensembl Gene

ENSMUSG00000031608

Gene Name

polypeptide N-acetylgalactosaminyltransferase 7

Synonyms

ppGaNTase-T7

MMRRC Submission

041697-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R4426 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57523828-57653032 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 57552572 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 209 (S209*)

Ref Sequence

ENSEMBL: ENSMUSP00000105945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]

Predicted Effect

probably null
Transcript: ENSMUST00000034021
AA Change: S209*

SMART Domains

Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: S209*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	3e-28	PFAM
Pfam:Glyco_tranf_2_2	210	490	2e-7	PFAM
Pfam:Glyco_transf_7C	375	445	1.8e-8	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104338

Predicted Effect

probably null
Transcript: ENSMUST00000110316
AA Change: S209*

SMART Domains

Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: S209*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	8.2e-27	PFAM
Pfam:Glyco_tranf_2_2	210	490	1.3e-7	PFAM
Pfam:Glyco_transf_7C	369	445	9.3e-9	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156907

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	G	T	5: 90,572,783	C271F	probably damaging	Het
Arhgef39	C	T	4: 43,497,112	G293E	possibly damaging	Het
Atp8a1	A	C	5: 67,774,828	I206S	probably benign	Het
BC053393	T	A	11: 46,584,420	F147L	probably benign	Het
Cacnb2	A	T	2: 14,975,215	R290*	probably null	Het
Ccdc137	T	C	11: 120,460,248	S159P	probably damaging	Het
Chil5	A	G	3: 106,019,627	S231P	probably damaging	Het
Cic	C	T	7: 25,294,008		probably benign	Het
Csmd3	A	G	15: 47,669,185	V2434A	possibly damaging	Het
Csnk1a1	A	G	18: 61,585,310		probably benign	Het
D330045A20Rik	T	C	X: 139,480,896	V134A	possibly damaging	Het
Eif4e1b	T	C	13: 54,784,483	S49P	probably benign	Het
Far1	C	A	7: 113,550,001	P194Q	probably benign	Het
Fut4	T	C	9: 14,751,381	T206A	possibly damaging	Het
Gas2l1	A	G	11: 5,063,908	V184A	probably benign	Het
Herc1	T	C	9: 66,496,005	L4402P	probably damaging	Het
Hoxa13	C	A	6: 52,260,729		probably benign	Het
Ighv1-9	T	A	12: 114,583,796	K42*	probably null	Het
Kif20a	C	T	18: 34,631,941	R743W	probably damaging	Het
Lama2	G	A	10: 27,422,558	R181C	probably damaging	Het
Lrp2	G	T	2: 69,506,348	T1360K	probably benign	Het
Map4k1	G	A	7: 28,988,595	V177I	probably damaging	Het
Nbea	G	A	3: 56,082,379	T352I	probably damaging	Het
Nde1	A	G	16: 14,188,336	T82A	possibly damaging	Het
Nes	A	G	3: 87,976,042	E536G	probably damaging	Het
Nms	C	T	1: 38,939,296	P4L	probably benign	Het
Nrip1	T	C	16: 76,291,405	Q1088R	possibly damaging	Het
Nwd1	A	G	8: 72,666,795	K229E	probably damaging	Het
Olfr583	T	C	7: 103,051,811	L171P	probably damaging	Het
Olfr600	A	G	7: 103,346,083	Y282H	probably damaging	Het
Pcdhac2	T	A	18: 37,144,743	S259T	probably benign	Het
Pdcd5	T	C	7: 35,646,180	D102G	possibly damaging	Het
Pgm2	T	C	4: 99,962,140	V169A	probably benign	Het
Pitpnm2	C	T	5: 124,142,123	E121K	probably benign	Het
Plin3	T	C	17: 56,286,555	Y53C	probably damaging	Het
Poc1b	T	C	10: 99,155,139		probably null	Het
Polr2c	A	T	8: 94,863,462	N232Y	probably damaging	Het
Ppp1r9b	A	T	11: 95,001,324	R188S	possibly damaging	Het
Rab36	G	A	10: 75,044,496	V63I	probably damaging	Het
Rab3gap2	G	A	1: 185,235,342	S141N	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Rnf166	A	G	8: 122,470,240	L91P	probably damaging	Het
Robo2	T	A	16: 73,948,266	M200L	probably damaging	Het
Rp1	A	T	1: 4,347,924	H988Q	probably benign	Het
Sbno2	T	C	10: 80,072,358	K69R	probably null	Het
Sgce	G	A	6: 4,691,459	A295V	probably damaging	Het
Shc3	C	G	13: 51,480,094		probably null	Het
Slc44a1	T	C	4: 53,563,286	V671A	probably benign	Het
Sptbn4	A	C	7: 27,423,798	L233R	probably damaging	Het
Stx5a	A	G	19: 8,749,740	T252A	probably benign	Het
Tmem87b	C	T	2: 128,846,750	A485V	probably benign	Het
Tns1	A	G	1: 73,985,749	I403T	probably damaging	Het
Ttll10	G	C	4: 156,048,561	T22R	possibly damaging	Het
Uevld	A	T	7: 46,940,142	S293T	probably benign	Het
Utp18	T	C	11: 93,866,438	N467D	probably damaging	Het
Vmn1r39	A	T	6: 66,805,361		probably null	Het
Vmn2r106	A	G	17: 20,285,379	S18P	probably benign	Het
Vmn2r61	A	T	7: 42,300,733	H859L	probably benign	Het
Vmn2r61	T	C	7: 42,300,735	S860P	probably benign	Het
Vmn2r72	G	A	7: 85,737,828	R843*	probably null	Het
Vwc2	A	G	11: 11,154,235	T256A	probably damaging	Het
Zfp715	T	C	7: 43,311,092	D25G	probably damaging	Het

Other mutations in Galnt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Galnt7	APN	8	57540039	missense	probably damaging	1.00
IGL00538:Galnt7	APN	8	57552522	missense	possibly damaging	0.95
IGL00826:Galnt7	APN	8	57540071	nonsense	probably null
IGL00951:Galnt7	APN	8	57583824	missense	probably damaging	0.96
IGL01662:Galnt7	APN	8	57531735	splice site	probably benign
IGL02280:Galnt7	APN	8	57536790	missense	probably damaging	1.00
IGL02832:Galnt7	APN	8	57552497	missense	probably damaging	1.00
IGL02936:Galnt7	APN	8	57584214	missense	probably benign
IGL03083:Galnt7	APN	8	57526189	missense	probably damaging	0.98
IGL03387:Galnt7	APN	8	57526178	missense	probably benign	0.01
R0400:Galnt7	UTSW	8	57583989	missense	probably damaging	0.99
R0553:Galnt7	UTSW	8	57552430	splice site	probably benign
R1463:Galnt7	UTSW	8	57652858	missense	probably benign
R1487:Galnt7	UTSW	8	57540039	missense	probably damaging	1.00
R1791:Galnt7	UTSW	8	57542530	missense	probably benign	0.05
R1817:Galnt7	UTSW	8	57538178	missense	probably damaging	1.00
R1962:Galnt7	UTSW	8	57532714	missense	probably benign	0.13
R3855:Galnt7	UTSW	8	57532624	splice site	probably benign
R3856:Galnt7	UTSW	8	57532624	splice site	probably benign
R4232:Galnt7	UTSW	8	57652966	missense	probably benign
R4396:Galnt7	UTSW	8	57538181	missense	probably damaging	1.00
R4610:Galnt7	UTSW	8	57545769	missense	probably damaging	0.99
R4745:Galnt7	UTSW	8	57542727	intron	probably benign
R4794:Galnt7	UTSW	8	57545363	missense	probably damaging	1.00
R5014:Galnt7	UTSW	8	57545380	missense	probably damaging	1.00
R5177:Galnt7	UTSW	8	57584027	missense	possibly damaging	0.87
R5682:Galnt7	UTSW	8	57583933	nonsense	probably null
R6122:Galnt7	UTSW	8	57526166	missense	probably damaging	0.99
R6276:Galnt7	UTSW	8	57536578	splice site	probably null
R6684:Galnt7	UTSW	8	57538109	missense	probably benign	0.16
R6752:Galnt7	UTSW	8	57652951	missense	probably damaging	1.00
R7464:Galnt7	UTSW	8	57584020	missense	possibly damaging	0.95
R7491:Galnt7	UTSW	8	57552518	missense	probably damaging	0.97
R7547:Galnt7	UTSW	8	57583962	missense	possibly damaging	0.48
R8093:Galnt7	UTSW	8	57532705	missense	probably benign	0.00
R8221:Galnt7	UTSW	8	57552566	missense	possibly damaging	0.93
R8248:Galnt7	UTSW	8	57538188	missense	probably benign	0.34
R8402:Galnt7	UTSW	8	57542919	missense	probably damaging	0.98
X0050:Galnt7	UTSW	8	57552444	frame shift	probably null
X0062:Galnt7	UTSW	8	57583908	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- GTGATTGACTTATTTTCTAGCGCAG -3'
(R):5'- ATACCGAGGAGCTTTATCTAAGAGTC -3'

Sequencing Primer
(F):5'- TCTAGCGCAGATGTCAAGTC -3'
(R):5'- CAGTTTCTGCTGAGATCCAAAGAGC -3'

Posted On

2015-07-07