Incidental Mutation 'R4426:Plin3'
ID328204
Institutional Source Beutler Lab
Gene Symbol Plin3
Ensembl Gene ENSMUSG00000024197
Gene Nameperilipin 3
SynonymsTip47, M6prbp1, 1300012C15Rik
MMRRC Submission 041697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4426 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56278962-56290511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56286555 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 53 (Y53C)
Ref Sequence ENSEMBL: ENSMUSP00000019726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019726]
PDB Structure
Crystal Structure of the C-terminus of TIP47 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000019726
AA Change: Y53C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000019726
Gene: ENSMUSG00000024197
AA Change: Y53C

DomainStartEndE-ValueType
Pfam:Perilipin 19 415 1.5e-166 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mannose 6-phophate receptors (MPRs) deliver lysosomal hydrolase from the Golgi to endosomes and then return to the Golgi complex. The protein encoded by this gene interacts with the cytoplasmic domains of both cation-independent and cation-dependent MPRs, and is required for endosome-to-Golgi transport. This protein also binds directly to the GTPase RAB9 (RAB9A), a member of the RAS oncogene family. The interaction with RAB9 has been shown to increase the affinity of this protein for its cargo. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a null mutation display enhanced cold tolerance and increased beige adipocyte formation and thermogenic activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik G T 5: 90,572,783 C271F probably damaging Het
Arhgef39 C T 4: 43,497,112 G293E possibly damaging Het
Atp8a1 A C 5: 67,774,828 I206S probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
Cacnb2 A T 2: 14,975,215 R290* probably null Het
Ccdc137 T C 11: 120,460,248 S159P probably damaging Het
Chil5 A G 3: 106,019,627 S231P probably damaging Het
Cic C T 7: 25,294,008 probably benign Het
Csmd3 A G 15: 47,669,185 V2434A possibly damaging Het
Csnk1a1 A G 18: 61,585,310 probably benign Het
D330045A20Rik T C X: 139,480,896 V134A possibly damaging Het
Eif4e1b T C 13: 54,784,483 S49P probably benign Het
Far1 C A 7: 113,550,001 P194Q probably benign Het
Fut4 T C 9: 14,751,381 T206A possibly damaging Het
Galnt7 G T 8: 57,552,572 S209* probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Hoxa13 C A 6: 52,260,729 probably benign Het
Ighv1-9 T A 12: 114,583,796 K42* probably null Het
Kif20a C T 18: 34,631,941 R743W probably damaging Het
Lama2 G A 10: 27,422,558 R181C probably damaging Het
Lrp2 G T 2: 69,506,348 T1360K probably benign Het
Map4k1 G A 7: 28,988,595 V177I probably damaging Het
Nbea G A 3: 56,082,379 T352I probably damaging Het
Nde1 A G 16: 14,188,336 T82A possibly damaging Het
Nes A G 3: 87,976,042 E536G probably damaging Het
Nms C T 1: 38,939,296 P4L probably benign Het
Nrip1 T C 16: 76,291,405 Q1088R possibly damaging Het
Nwd1 A G 8: 72,666,795 K229E probably damaging Het
Olfr583 T C 7: 103,051,811 L171P probably damaging Het
Olfr600 A G 7: 103,346,083 Y282H probably damaging Het
Pcdhac2 T A 18: 37,144,743 S259T probably benign Het
Pdcd5 T C 7: 35,646,180 D102G possibly damaging Het
Pgm2 T C 4: 99,962,140 V169A probably benign Het
Pitpnm2 C T 5: 124,142,123 E121K probably benign Het
Poc1b T C 10: 99,155,139 probably null Het
Polr2c A T 8: 94,863,462 N232Y probably damaging Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rab3gap2 G A 1: 185,235,342 S141N probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rnf166 A G 8: 122,470,240 L91P probably damaging Het
Robo2 T A 16: 73,948,266 M200L probably damaging Het
Rp1 A T 1: 4,347,924 H988Q probably benign Het
Sbno2 T C 10: 80,072,358 K69R probably null Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Shc3 C G 13: 51,480,094 probably null Het
Slc44a1 T C 4: 53,563,286 V671A probably benign Het
Sptbn4 A C 7: 27,423,798 L233R probably damaging Het
Stx5a A G 19: 8,749,740 T252A probably benign Het
Tmem87b C T 2: 128,846,750 A485V probably benign Het
Tns1 A G 1: 73,985,749 I403T probably damaging Het
Ttll10 G C 4: 156,048,561 T22R possibly damaging Het
Uevld A T 7: 46,940,142 S293T probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn1r39 A T 6: 66,805,361 probably null Het
Vmn2r106 A G 17: 20,285,379 S18P probably benign Het
Vmn2r61 A T 7: 42,300,733 H859L probably benign Het
Vmn2r61 T C 7: 42,300,735 S860P probably benign Het
Vmn2r72 G A 7: 85,737,828 R843* probably null Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp715 T C 7: 43,311,092 D25G probably damaging Het
Other mutations in Plin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Plin3 APN 17 56279814 missense probably damaging 1.00
IGL01522:Plin3 APN 17 56280799 nonsense probably null
IGL01793:Plin3 APN 17 56281540 missense probably benign
IGL02355:Plin3 APN 17 56286636 missense probably benign 0.24
IGL02362:Plin3 APN 17 56286636 missense probably benign 0.24
R0053:Plin3 UTSW 17 56279892 missense probably damaging 1.00
R0053:Plin3 UTSW 17 56279892 missense probably damaging 1.00
R1458:Plin3 UTSW 17 56284337 missense probably benign 0.05
R1900:Plin3 UTSW 17 56279824 missense possibly damaging 0.47
R2107:Plin3 UTSW 17 56284391 missense probably benign 0.01
R2173:Plin3 UTSW 17 56279891 missense possibly damaging 0.77
R3030:Plin3 UTSW 17 56284184 missense possibly damaging 0.64
R3808:Plin3 UTSW 17 56286275 missense probably damaging 1.00
R3872:Plin3 UTSW 17 56284181 missense probably damaging 1.00
R5991:Plin3 UTSW 17 56286576 missense probably damaging 0.99
R6261:Plin3 UTSW 17 56281488 nonsense probably null
R6516:Plin3 UTSW 17 56286223 missense probably damaging 0.99
R7225:Plin3 UTSW 17 56286541 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACGGTAAATGCCCTCAATGG -3'
(R):5'- TAGCCCAGCTGATCTATCCC -3'

Sequencing Primer
(F):5'- CCTCAATGGTGGGCAGAGAC -3'
(R):5'- TGAGCTTCTCACCTGGTC -3'
Posted On2015-07-07