Incidental Mutation 'R0038:Hcrtr2'
Institutional Source Beutler Lab
Gene Symbol Hcrtr2
Ensembl Gene ENSMUSG00000032360
Gene Namehypocretin (orexin) receptor 2
SynonymsmOXR2, OX2r, mOX2aR, mOX2bR
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0038 (G1)
Quality Score217
Status Validated (trace)
Chromosomal Location76225880-76323856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76259681 bp
Amino Acid Change Serine to Threonine at position 125 (S125T)
Ref Sequence ENSEMBL: ENSMUSP00000139377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063140] [ENSMUST00000184757]
Predicted Effect probably benign
Transcript: ENSMUST00000063140
AA Change: S125T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058230
Gene: ENSMUSG00000032360
AA Change: S125T

Pfam:7tm_1 71 364 2.2e-59 PFAM
Pfam:Orexin_rec2 386 443 1.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184757
AA Change: S125T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000139377
Gene: ENSMUSG00000032360
AA Change: S125T

Pfam:7tm_1 71 364 1.2e-59 PFAM
Pfam:Orexin_rec2 383 443 2.2e-47 PFAM
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor involved in the regulation of feeding behavior. The encoded protein binds the hypothalamic neuropeptides orexin A and orexin B. A related gene (HCRTR1) encodes a G-protein coupled receptor that selectively binds orexin A. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice bearing targeted mutations in this gene exhibit fragmentation of sleep/wake states with similarity to narcolepsy and rare or very rare episodes of cataplexy. In addition, mice homozygous for a funtionally null allele display enhanced depression-likebehavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pgm3 A T 9: 86,564,673 probably benign Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Hcrtr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Hcrtr2 APN 9 76228155 missense possibly damaging 0.86
IGL00492:Hcrtr2 APN 9 76246441 missense probably damaging 1.00
IGL00782:Hcrtr2 APN 9 76230497 utr 3 prime probably benign
IGL03096:Hcrtr2 APN 9 76254626 missense probably benign 0.01
PIT4508001:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0038:Hcrtr2 UTSW 9 76259681 missense probably benign 0.00
R0268:Hcrtr2 UTSW 9 76228188 missense probably benign
R0389:Hcrtr2 UTSW 9 76246380 nonsense probably null
R0499:Hcrtr2 UTSW 9 76254672 missense probably damaging 1.00
R0607:Hcrtr2 UTSW 9 76230684 missense probably benign 0.00
R1622:Hcrtr2 UTSW 9 76323440 missense probably benign 0.03
R1637:Hcrtr2 UTSW 9 76232999 missense probably benign
R1698:Hcrtr2 UTSW 9 76246453 missense probably damaging 1.00
R1856:Hcrtr2 UTSW 9 76259785 missense probably damaging 1.00
R1876:Hcrtr2 UTSW 9 76246345 critical splice donor site probably null
R3411:Hcrtr2 UTSW 9 76233008 missense probably benign 0.30
R4469:Hcrtr2 UTSW 9 76230556 missense probably benign 0.30
R4560:Hcrtr2 UTSW 9 76254688 missense probably damaging 1.00
R4797:Hcrtr2 UTSW 9 76254534 missense probably damaging 1.00
R5001:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R5027:Hcrtr2 UTSW 9 76323296 missense probably benign 0.31
R5611:Hcrtr2 UTSW 9 76323314 missense probably damaging 0.98
R5770:Hcrtr2 UTSW 9 76259666 missense probably damaging 0.98
R5826:Hcrtr2 UTSW 9 76323287 missense probably benign 0.32
R6023:Hcrtr2 UTSW 9 76230604 missense probably benign 0.00
R6110:Hcrtr2 UTSW 9 76259782 missense probably damaging 1.00
R7084:Hcrtr2 UTSW 9 76230660 missense probably benign 0.21
R7103:Hcrtr2 UTSW 9 76254511 missense probably benign 0.00
R7173:Hcrtr2 UTSW 9 76259731 missense probably damaging 1.00
R7783:Hcrtr2 UTSW 9 76232914 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tccaaaccagaaacaatgcc -3'
Posted On2013-05-09