Incidental Mutation 'R0038:Pgm3'
ID32822
Institutional Source Beutler Lab
Gene Symbol Pgm3
Ensembl Gene ENSMUSG00000056131
Gene Namephosphoglucomutase 3
SynonymsPgm-3, GlcNAc-P mutase, 2810473H05Rik
MMRRC Submission 038332-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock #R0038 (G1)
Quality Score190
Status Validated (trace)
Chromosome9
Chromosomal Location86554377-86571842 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 86564673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000072390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070064] [ENSMUST00000072585]
Predicted Effect probably benign
Transcript: ENSMUST00000070064
SMART Domains Protein: ENSMUSP00000070871
Gene: ENSMUSG00000056131

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 6.5e-9 PFAM
Pfam:PGM_PMM_I 96 174 4.3e-9 PFAM
Pfam:PGM_PMM_IV 443 528 8.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072585
SMART Domains Protein: ENSMUSP00000072390
Gene: ENSMUSG00000056131

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 44 102 2.5e-10 PFAM
Pfam:PGM_PMM_I 95 175 3.6e-11 PFAM
Pfam:PGM_PMM_II 181 291 9.4e-14 PFAM
SCOP:d3pmga3 298 374 1e-8 SMART
Pfam:PGM_PMM_IV 383 487 8.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187251
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphohexose mutase family. The encoded protein mediates both glycogen formation and utilization by catalyzing the interconversion of glucose-1-phosphate and glucose-6-phosphate. A non-synonymous single nucleotide polymorphism in this gene may play a role in resistance to diabetic nephropathy and neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility, anemia, leukopenia, thrombocytopenia, abnormal pancreatic and salivary gland morphology, and splenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agfg1 T C 1: 82,886,102 probably benign Het
Ankrd28 A T 14: 31,708,035 M892K probably damaging Het
Arhgef25 T C 10: 127,186,865 probably benign Het
Arl9 G A 5: 77,006,475 E17K probably benign Het
Bbs9 G A 9: 22,504,094 V105I probably benign Het
Celsr1 A T 15: 85,929,419 N1997K possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Cldn8 A G 16: 88,563,034 M1T probably null Het
Clec11a A G 7: 44,306,482 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col19a1 A T 1: 24,559,744 L56Q unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cyp2b10 G A 7: 25,914,862 A254T probably benign Het
Ddx39 T C 8: 83,722,498 L305P probably damaging Het
Depdc5 A G 5: 32,868,853 E60G probably benign Het
Eif2ak2 T A 17: 78,863,955 M340L probably benign Het
Etl4 A T 2: 20,743,574 H39L probably damaging Het
Fat3 T C 9: 15,915,010 T4549A probably damaging Het
Fbxw28 A T 9: 109,338,540 W50R probably damaging Het
Ggt7 T C 2: 155,502,781 D214G probably benign Het
Gramd1b G A 9: 40,317,526 T252M probably damaging Het
Grin1 T C 2: 25,297,459 N613S probably null Het
Hcrtr2 A T 9: 76,259,681 S125T probably benign Het
Hr T C 14: 70,568,085 L1091P probably damaging Het
Htr2a T G 14: 74,706,247 S422R probably benign Het
Ighmbp2 A G 19: 3,262,097 S886P probably damaging Het
Iqcg C A 16: 33,045,642 L110F probably benign Het
Kirrel3 T A 9: 34,911,770 probably null Het
Kremen1 A C 11: 5,207,703 probably benign Het
Lama2 T C 10: 26,986,797 D2990G probably benign Het
Lin52 C G 12: 84,529,725 L111V probably damaging Het
Myh15 T C 16: 49,071,141 probably benign Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Nlrp1b A G 11: 71,172,171 S685P possibly damaging Het
Oog4 T C 4: 143,438,944 D211G probably benign Het
Oscar A G 7: 3,616,073 V2A probably benign Het
Pdzd8 A G 19: 59,299,596 I1124T possibly damaging Het
Pnpla5 A G 15: 84,122,513 Y90H probably damaging Het
Polr1b C T 2: 129,115,668 R548* probably null Het
Ptprg T A 14: 12,213,710 M1026K probably damaging Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rapgef2 T C 3: 79,069,396 I1368V probably benign Het
Rnf168 T C 16: 32,298,995 V458A probably benign Het
Rnf32 T C 5: 29,205,654 probably benign Het
Sclt1 T C 3: 41,629,508 probably benign Het
Serpina12 A G 12: 104,037,957 F139L probably damaging Het
Sos2 T G 12: 69,596,693 Q971P probably damaging Het
Stag3 T A 5: 138,301,036 probably null Het
Stard5 T C 7: 83,636,743 probably benign Het
Stard9 T A 2: 120,695,832 C857S probably benign Het
Suclg1 A G 6: 73,260,503 E77G probably benign Het
Trpm7 A G 2: 126,795,468 S204P probably damaging Het
Ush2a G T 1: 188,626,612 G2112C probably benign Het
Vmn2r15 T A 5: 109,293,144 T283S possibly damaging Het
Wdr6 A T 9: 108,572,969 V1120D probably damaging Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Pgm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Pgm3 APN 9 86561879 missense probably damaging 0.96
IGL01865:Pgm3 APN 9 86555318 missense possibly damaging 0.85
IGL02800:Pgm3 APN 9 86555378 missense possibly damaging 0.94
R6592_Pgm3_648 UTSW 9 86559443 missense possibly damaging 0.87
R0038:Pgm3 UTSW 9 86564673 splice site probably benign
R0266:Pgm3 UTSW 9 86567533 missense probably benign 0.00
R0536:Pgm3 UTSW 9 86567536 missense possibly damaging 0.83
R0617:Pgm3 UTSW 9 86556190 critical splice donor site probably null
R1499:Pgm3 UTSW 9 86570287 missense probably benign 0.01
R1780:Pgm3 UTSW 9 86556204 missense probably damaging 1.00
R1838:Pgm3 UTSW 9 86569233 missense probably benign 0.03
R1882:Pgm3 UTSW 9 86565690 missense possibly damaging 0.72
R1920:Pgm3 UTSW 9 86558478 missense possibly damaging 0.47
R2095:Pgm3 UTSW 9 86556341 missense probably damaging 0.99
R2378:Pgm3 UTSW 9 86562667 missense probably damaging 0.97
R2679:Pgm3 UTSW 9 86569321 missense probably benign 0.32
R3021:Pgm3 UTSW 9 86567535 missense possibly damaging 0.95
R3686:Pgm3 UTSW 9 86559510 missense probably benign 0.37
R4490:Pgm3 UTSW 9 86561840 missense probably damaging 1.00
R4651:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4652:Pgm3 UTSW 9 86558470 missense probably benign 0.01
R4718:Pgm3 UTSW 9 86570395 missense probably benign 0.00
R4883:Pgm3 UTSW 9 86569325 missense probably damaging 1.00
R4940:Pgm3 UTSW 9 86559476 missense probably damaging 1.00
R4973:Pgm3 UTSW 9 86562679 missense probably benign
R4990:Pgm3 UTSW 9 86558412 missense probably damaging 0.97
R5357:Pgm3 UTSW 9 86556257 nonsense probably null
R5870:Pgm3 UTSW 9 86570361 missense probably damaging 0.99
R6592:Pgm3 UTSW 9 86559443 missense possibly damaging 0.87
R6807:Pgm3 UTSW 9 86556502 intron probably null
R7152:Pgm3 UTSW 9 86567540 missense probably benign 0.13
R7274:Pgm3 UTSW 9 86562597 missense probably damaging 1.00
X0028:Pgm3 UTSW 9 86569355 missense probably damaging 1.00
Z1088:Pgm3 UTSW 9 86564707 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTGACAAGGCACCTGATTCTG -3'
(R):5'- TCGCACAGTGAAATGGCTCTAACAG -3'

Sequencing Primer
(F):5'- AGCTCTCAGTCTAAAGTGCTC -3'
(R):5'- catgcatCCACTTTGGTGAC -3'
Posted On2013-05-09