Incidental Mutation 'R4427:Sgce'
ID328225
Institutional Source Beutler Lab
Gene Symbol Sgce
Ensembl Gene ENSMUSG00000004631
Gene Namesarcoglycan, epsilon
Synonymse-SG
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location4674350-4747207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4691459 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 295 (A295V)
Ref Sequence ENSEMBL: ENSMUSP00000120718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004750] [ENSMUST00000090686] [ENSMUST00000101677] [ENSMUST00000115577] [ENSMUST00000115579] [ENSMUST00000126151] [ENSMUST00000133306]
Predicted Effect probably damaging
Transcript: ENSMUST00000004750
AA Change: A336V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004750
Gene: ENSMUSG00000004631
AA Change: A336V

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090686
AA Change: A336V

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088185
Gene: ENSMUSG00000004631
AA Change: A336V

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 412 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101677
AA Change: A336V

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099200
Gene: ENSMUSG00000004631
AA Change: A336V

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115577
AA Change: A372V

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111240
Gene: ENSMUSG00000004631
AA Change: A372V

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
CADG 85 193 1.86e-10 SMART
low complexity region 457 468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115579
AA Change: A336V

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111242
Gene: ENSMUSG00000004631
AA Change: A336V

DomainStartEndE-ValueType
CADG 49 157 1.86e-10 SMART
low complexity region 421 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123907
SMART Domains Protein: ENSMUSP00000120910
Gene: ENSMUSG00000004631

DomainStartEndE-ValueType
CADG 32 140 1.86e-10 SMART
low complexity region 395 406 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126151
AA Change: A295V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120718
Gene: ENSMUSG00000004631
AA Change: A295V

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 389 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128109
Predicted Effect possibly damaging
Transcript: ENSMUST00000133306
AA Change: A336V

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121964
Gene: ENSMUSG00000004631
AA Change: A336V

DomainStartEndE-ValueType
CADG 26 134 1.86e-10 SMART
low complexity region 398 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153284
Meta Mutation Damage Score 0.7788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous or heterozygous for a knock-out allele display significantly increased myoclonus and deficits in motor coordination and balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Ccdc88b C T 19: 6,850,572 E878K probably damaging Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Sgce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Sgce APN 6 4689750 missense probably damaging 1.00
IGL01399:Sgce APN 6 4746997 missense probably damaging 1.00
IGL01796:Sgce APN 6 4711326 missense probably damaging 1.00
IGL02403:Sgce APN 6 4694059 missense probably damaging 1.00
IGL02421:Sgce APN 6 4694187 splice site probably benign
IGL02547:Sgce APN 6 4711301 splice site probably benign
IGL02585:Sgce APN 6 4711388 splice site probably benign
IGL03355:Sgce APN 6 4689738 missense probably damaging 1.00
IGL03374:Sgce APN 6 4689718 nonsense probably null
PIT4445001:Sgce UTSW 6 4689654 missense possibly damaging 0.85
R0345:Sgce UTSW 6 4718019 missense probably damaging 1.00
R0611:Sgce UTSW 6 4689621 missense probably damaging 1.00
R0719:Sgce UTSW 6 4689753 missense probably damaging 1.00
R1162:Sgce UTSW 6 4691419 splice site probably benign
R1630:Sgce UTSW 6 4719476 missense probably damaging 0.98
R1694:Sgce UTSW 6 4689709 missense probably damaging 1.00
R1759:Sgce UTSW 6 4689765 missense probably damaging 1.00
R1897:Sgce UTSW 6 4691511 missense probably benign 0.00
R2231:Sgce UTSW 6 4730066 missense probably benign 0.44
R3429:Sgce UTSW 6 4730008 missense probably benign 0.01
R4011:Sgce UTSW 6 4691563 nonsense probably null
R4426:Sgce UTSW 6 4691459 missense probably damaging 0.97
R4651:Sgce UTSW 6 4689560 intron probably benign
R4652:Sgce UTSW 6 4689560 intron probably benign
R4921:Sgce UTSW 6 4694153 missense probably damaging 1.00
R4974:Sgce UTSW 6 4689630 missense probably benign 0.00
R6271:Sgce UTSW 6 4730015 missense possibly damaging 0.81
R6898:Sgce UTSW 6 4689666 missense probably damaging 1.00
R7317:Sgce UTSW 6 4691615 missense probably benign 0.00
R7347:Sgce UTSW 6 4694106 missense probably damaging 1.00
R7512:Sgce UTSW 6 4707192 missense possibly damaging 0.75
R7671:Sgce UTSW 6 4691564 missense probably damaging 1.00
R8009:Sgce UTSW 6 4691636 missense probably damaging 0.99
X0026:Sgce UTSW 6 4689638 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGGCCCCTAATTTGTTTGCTAGAC -3'
(R):5'- GCAAGTGTCCACCTATCAGG -3'

Sequencing Primer
(F):5'- GGGAATAAAGTACTGCTGTTTGATC -3'
(R):5'- GTCCACCTATCAGGAAGTAGTTCG -3'
Posted On2015-07-07